Description :
From Genome Similarity Track
Location :
Scaffold_110:20250- 27020
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_110-snap-gene-0.18Gene of unknown function
Pytir_DAOMBR486snap-pir_contig_110-abinit-gene-0.69Conserved gene of unknown function
Pytir_DAOMBR486fgenesh_masked-pir_contig_110-abinit-gene-0.48Chromodomain-helicase-DNA-binding protein

Sequence
6770 bases(100 bases per row)
CTTCAAGCGTTCAGCAAGACAACCACTGGCTGCTGGCTGGTAATGTGCGCAAAACCAAACGGCAACCACTGGCAGCTGTAACCGCCGGTTGCGTCAATCT
GGCCTATATTTTCAAATAAAGAAAATACTTTCGCGCCAGATTTTCAAACTGTCCCACTTTGGCCTCTGCCGAAATGCGGATGATCCGTATGCGGAAAAGC
AATAGTCAGTCAGGGTATTGATGGGGCTCGTGCAATAATGACAGAGGAGGCATGGCCCATTCCTATTTCATCATCTCAGATTGCTCACTCCAGTTCAACA
ATCCGCTGTGACCATGGTGCGGGATGCCTCTTCGTGGGCATTTATGCACGCACCAATGCAAACAACTCAACTCCTCATATGCCGAGGTGGACTCAGTTAT
GCTAGCTTTGGTCACTGCAATGGACCAACTCTACCAGAGTAAAGGGCAACCAAAGTGTGGTGTGGTGTGCGTGCGTGTGTGTGTGTGTGCTTTGCGCATT
TTGCGTGCTGCGAGCACTCACAGGGCTGTAACATCGCCATCTGCAACGGTTTCAACCCCCAAAGCGACGCACACTCTTGTGCTTTCAAGATTACAAAATG
AAAAGACCGTTGTACCTCTGCAGCAAGCCAACAAGCAACCCTCACAATCCACAACTGTGCGATGTGGATTATGCTGGGCGAGGTTTCTTTGACAACTGGA
ACTGGAGATGCACTCGAACAGGCACACATCAGGCAATGCCCATTCCTGTCACAGGGCTCTGAAGATGTAGCCATAGTTTGTCAATGCGCAAGGATCGCAA
ATGCAAGCGCTGTTTCCTTTCGCCAGTATCAGTATTTATTGGCCGGCAGGCAGCTTTGCCTTTCCTTCCAAAGTGTCCCTGGTTGTCAATCAAGCGCAAC
ACGCGGCAGGTGTATGCTCGGGCTGTTGGCTTACGTGTGCATCGACAATATCGATATCTACACAATACGCGCCATGTGCAAATGCAGCACTGACTGCATT
GCCAGGTGGGAAAAGCCGGCTTGCATTTTTGCTGTCAACATGATCCCGTGTTGAAAACAGTTTTTGGGGGATTATTGTGAAATTTTGTGAATGTTATGAA
TACAACAAAAAATAATTAACACAGCCCTTTAGGGTTGTTCCTGCTTGCTTGCTGTTTGCGTGCAGGACGCAAAGCAAAGCCCTGACCTTGCAAGGGCGTG
TGTGTGTGTGAGAAAATCAACCGCTGCATATGATGGCCAGACGCGCAACCCTGTATCCCAGGAAGCAAAGCGCGCAAAAAATGATAGGCGGCTCTCGCCT
TTTCAGTGAAGGGTGAGGGAGAGAAAGAAGCCCAAGGAACAAAACCTGATTGCCCAGTTTAAGTAGATAGACAGCAGATGGACTTCTGTTGTGCGCGTTA
CTTCGGGCCGCTGGACGGGTGATTTCGATCCCAGCCGCTTTGGTACTGTCGCTTGCTTATGCTTTTTATGGCTGGCCTGACTGGCTGAAAGCTCCTTCCG
GCTCGGACCCGCGAGTTGGACGGCATCATCTCCCACACCCTGGCCGACCGGCCGGCCGGCCGTCAGTCACGAATTGGCGAAGCGCGTGCGCGTCCCCCGT
CCGCACAATTGAATCCCAGCCGTGGCCGTCTACTGCCCTCAGTCGCAGTCCTTCCTTCCCCAGACCAGAGTTCCAGCTAGTTTATTGCGTCAAAAGCTGC
TTTTCCTGTCGCCGTCCGCCCGTCAGTCCAGCCCGCTGTCCATATTTCCACCAAGTCTTTTACGTCAAGCGCGTCTCTCGACTTCTTCTTGTTCGAATTT
CTTCATAGAGAGCGTGACACAGAGACATCTCACGTTGAGCTCAGGTGAGTCTTCTGAAGAGTTCGAACCCATTGCCGTGGCCGATTTTTTCATTTGTGCG
CGCCAAGAGCCGCGAAAATAGCGCCCATCCTCCAAGTTTATTGCGATTTTTTAATTAGAACCCATTCATTTTGCTGTGTTGCATGTGTGTGCTTGCTTGC
GTGTGTCTAACTCTTGTCACTTGTTGTTTTCTTTTCTCGCGGGTTGCTTCTCTCTGCACAACAGCCAGACTTGTTCTCTCGCTTCTACCGTAAAGCAGAA
GCGGGCTTCTCTTCTCGCCAAGACGTCCGGATTCTGACTCCAACACCGACAAGGCCAACTCCTCTCACAACACGAAAAGGCAACCAGGGATGCCCCGCTC
GATATCCTTTTTCCAGAGCGAGCGCTCCACCACATCCGCAACAGGTGCGTTCGCGTGTGCATTCGATACTTGCTTGCTTACGTTTTCTACGCTTGCGACC
GGCCAGGGCCAGCCCAGACGGCCGTCCGCGTCCGCTTGTCCGTCGTCTCTGCGGACGCGAGCGAGTGGTCGCCAAGGGCCAGGGCAGCAGCCACTGCGGC
GTCACACACGGCAGTCAGTTGGATACATTCGGTACCAATGCTGGCTGTCGACCGTCCGCANNNNNNNNNNNNNNNNNNNNNNNNNAAAAAGTTGACCCAT
GTTGGTCCGCGGCGTCCACTTGCACCCCACTTGTGTGTCCCCCTACACCGTGTATCTGGTCTGACTTGTCTCGTGCTTGCTTGTTTGTGTGTTTTCTTGT
GTTGCCGTTCGGGATCTTTGCTGTACCGATCGACCGCGTTCCTCCATTCCGCGATCCGCTACTATCCGCAATCCGCAGGCTTCATGACGACAACGACGCG
GACCACCACGACCACCACCACGACCACCACGATCCGCAGACATCCGCGCAGCGCCACCAGCAACAGCTTCTACAACATGCAGCTGGCCGGCGGTCCGCCC
TTGGCCGCACCCGCGTCCGCAGCCGCAACCGCGACGTCCAAAAACCACCACGATCCGAGCGCCGCACTCTTTCTGAAGGCCATGCTGGAGGAGCCGCACT
ACGCCGAGTTCTACGCCAACATCTGGAGCGATGAGGAGCACGAGAAGCGCAAGAAGCGCGGGAGACGCACGCGGCGCTTCACGGGCCCGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGACATCGCGCAGGTGGCGCACGTGGTCACGACCGTGCGCGACTTCAAGAGCGACTACGCGTCCGTGCCTCACGTGGACCTC
TTCAACATCTGGACTGACCGCGACCGCGCCTTTCTGCGCGACCACGAGCTGCCCGTGGTGGCGTCCACCAGTAGTAGAGCCGATGGGTTTGATGAGCAGG
ATGGCGTTGACGACGACGAAGATGCTATTGGTGGTGGTGGGGGTGCGTATGACTTCATGCATGCAAGCGGCGTCCCGTACTCGATGCGCTCGAATGCAGT
CCGTGGACAAGTGCGCAGCGACCTGCCGCGCCGCATCTCGGAAGCCAGTGACGAAGGCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGC
GTGCCGCCCACGGCGGCTGGCGGTGGATTCAACACGTACGCGCCTGTGATGGGCGGTCGCATGACGACGACCACCACGACGACGACGACGGAAAGGACCT
CTGCGCGCCACAGCGACCCGCTGGAAGACTCGTTCGCGGACTCGGACGCGAGCGCCAGCACTGTGCGCATGAGCGAANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGCGAGCTTAAACGCTCCAACACGCCGCTGGTGATGGGTCCCGACCCCGACGCGCGCATCAAGTCGATGCTGCTACCGTC
CGTGGACTCGGCCGTGCCGCCGCCGTCCAACAACGGTGACGGCTCAGTTGTGTTCTCGGTCGTGTTCATGGAAGAGCACGAGTGGAGTTGGTCAATCAAG
TTTTTGCTGGGCATCCACGAGCCGATCCGCCACGCGCTCTTTGTCATGGACCGCTCCTTGGAGCAGATGTTCCGGCAGCAGCAGATGACGGTGCTCGAGA
ACCATGTGCTCGAGTTCTTCACGTGGTTCAAGACCTACTTTGTCGAGTACCTCAAGTGCCAGTACGAACTCAAGATGAACGTGCTGCACCCTCTCATCAT
GGTCAGGTACTCGACCAAGATGGAGGTCATCAAGACTTACGAGGAGATCTACCAGTTCGTTGCGCAGATTCAGGACCAGCAGCGTCAGCTCACGTCGTCC
GTGGGCGTCAGGGACCCGTCGACGTGGCTTGCGCGTCTCGAAGCGCTCCAGAAGGCGATCCGCAAGCTCAACCTGACGCTGCATAGTGTGCTCAACCTCG
AGGAGAAGATGCTCCACGCGGCACTCAGCTCGACGTTCACGGAGAAGACGTTCCATCAGTACGTGATGCCGCGCGTATTCCGCTCGATCAAGGCGAAGCG
TGTGGTCGTGCCGTGGATCCTCGAGCGCAGCAAGGTCTGGGGCGGCGAGGCCGAGCAACAGAGCATTCAGGGCATGCTGCCGTTCTCGGCCAAGTTCCTC
TACCGCAAGATCTGGCGCCCGTACTTCATGGCCAACGTCGCCAGCGCCATGAAGAACCTGAACGAGTTTGTTGATAACTCGAGCGCGCTGATCCCCGCGG
CGGGCAACCGGAACAGCGACGGTGGCGTGTGCTCGATCCAGTGAGTGAATGAGTGAATGAGTGAGTGAGTGGGCAAATGAGCTCCTGGGAGGGAGAATGA
AATGGAGCTGCTCATAACAAGCGTTTGGTAAGGAGGGTGGTGGTGCCTTCTATTTATTTGAACAACTACCTTCGACAAATAAGCTAGCAACACGACATCA
ACATCGTGACGTGATAACAAACAAAACAAAACAAATGTATGGGATTCGAATTAATTAGCATGCCACGATTCTGTAAGCTTCCTCGTGTATGTGAGGTGGT
GGAAAGCTGTCTCCTTCTCATGGGGACACCATGCAATCTTGCATGCATCTCCTCCGATGGATATCACATTGCAAAATCTGTTTTGCTGTCGCACGTCGCA
TTTTGTTCGAAGCGCTGCTTAGCACCAAGGAAATAACATGTCGACCTACAGAATAGAAAAGCTTGGAGCATATGTGACGCCATTGACTACATTGAAGTGC
AGTTACGCTCTGAACACCTTCCTACTTTCCTTCTCTCTCGCCTTGATGGAAACAATCGAGCCTCTCTCTCTCTTCAAACTACCTCTACTTCGACAATTTT
CGCATTCTCGCACCCAATCAGTCATCGTTGGAGATCTCGCTGTCAGACACAGGGTTCTCGTGCGGGGAGACCGACGAAATCGGCTCCTTCGACGACCGCC
GCAATTTCTTCTTGGAGAGCGTCAGCTTGCCCTTCTTGCTGCTGCGGGCTTTGGACTTGGACGTCGCCTTTGGCGCTGAGCGAGCGCGAACACGAGGAGG
AACCACTGCCGATTCCGGCTCGGGGGTTGACACTGCGCTCGCAGGCTGCTCTTGGTCTTCTTGAGACAAGTGGCGCGTGCGAGTGCGCGTCCTCTTTGAA
GCGGGCAGCTCAGCGATCTCTTTACCATCATCATCGTCTGCTTTCGCTGGTGCTCTTTTCGAAGACAATGCAGTTTCTTCCTGCTCGTGTGGCGAGGTCT
TCTCTGGAACATCTGCCTCAAGCAGCTCCAACTTTGTCGGCTTGATCGAGCTCTGTGAAGCATACAAGGACAAGTCGACACGTTAGATACTTTCGCTTCG
TTGTGTGTCAGTGCACCATCAAAGTCAACATAAACAACCATAAACTCACCATCTTGATCTCCGCGCACGAGTTGCAGACCCAGTTCTCCTTTGCTTTCTT
TGCAGCCTGGCGACCCGACATGTTGACGCACTTCGGGTGGAACTTCAGACTGCACGACGCGCATTTCAGCGATAGCGTCGAGTCTTCAGGGTCATCCGCC
CCGCAGACACAGTATTTCTTCGGCTCGGCGTGCTTTGCGGCAGCGTGCTCTTTGCAGTATAACGAGTATGGAGAGTCGATAAACTCGCCGCCGCTTTCAA
GCGCGCACCGCAGATGGTAGTTGCAGCGGCACTTCTCCACAACGCACCCAACTGTCGCCCCAGTCTCTTTACACTTGGAGCACTTGAGCTGGCGTCCGCG
CTTGAGCGCGCGGGGCAAGTTGCAGAACACGCCGTTCGTCTTCACATACACTTCGGGCGAGTGGAGCGCGCAGTTCAAGTGAACAAACACCATCTCGACC
GACTTGTCCTGAAACTGCAAGCGCACAGGCGCTTCAACGAACGTGCCTTCGATCGACGAAGCAGCAGCTGAGTCCGGTTGCTTACCATTCTTCGCTGGCG
AGGGTCGACTCGATCGACGCGATTTGCTCTTTGAAGTTGGCGCATCCTCTGTCTTGGCGAGAATCTCCGCGACGATGTCGCCTTTGTGGCAGAATCCGCA
GATCTTGACGGACGGAATGCTCACACGCTTTCGCTTCCCAGACGGAGTCGCGTCTGCACCTCCATCCTCGTGGTCGACTTCGTGAAGTGAATCGTGTGCT
TCGTCGCCGACATCGTGGTAGCCATTGGATTGAGCAGCTTCTGATGAAGCAGTTGTACCGTTGCTGTCTGAAGTAGCTGCGTTCTTGGCACCGGCTTTCA
CTGGAGTCAGCGATTTCTTCTCTCGCAAATGCGTAGCGCAGATCATGAGGTTGGTGGAAAGTCGCATAAAATGCTCCGTGGACTTCATACAGTGCGGATG
GAACGCCTGCGAGCAGTGGATGCAGCTCACAACGCTCAGAGGTTTCTTGGACGGCTTCTTCTGTTCATCGACACGACAACTATGGCAGAAATGGCTTGGA
CACCGAAATCGTTTCTTGCCGACCCATTCGACACGCGGGTGCTTTGTTAAGCAGCCCTTGTGGTAAAAGC