Description :
From Genome Similarity Track
Location :
Scaffold_36:20248- 25428
Transcript NameFunction/comments
Phyag_g922unnamed protein product
Phyag_g923hypothetical protein PHYSODRAFT_445056
Phyag_g924hypothetical protein PHYSODRAFT_551960

Sequence
5180 bases(100 bases per row)
CACTTTGTCCTTAATACCCAGGGCGATCAACGCGTCAGCAGCCATTGCAATAACCTGTACCAATAAAGTGCGTCACACCACTGCAGTAAATATGTCAACA
ATTTTGATATGCAAGAGCGTACCTCTGCATCAACCGATGGTCCCGACGAGCCCACAAATTCCACGCCTGGCATAACGAATCACAAGGAGTGTTAGATGGA
GAACCAATGGCACAAACCTTTCCCACAGAAAAGTTACCAAACTGCTGGAACTCCCGATATCTTCCACGCTGAGGTCGCTCGTACCTGCAGCCCCAACAAC
AAACGAACGCTTAGTCAACATCCATGACTAGCAATAAAACCGGAAGCACCACGCACCGGAACATGCTGCCCGAATACGAAAGTTTCTGAGGCAGCGAAAA
CAGCAAGTTGTTGCTCACGAGAGCTCGCATGATGCCTGCAAAGAATAAGATACACCCATTCAACAAGCTCTTAGCTGGTTTGCACCAAGCACACGATGCG
TGACTCAACCGGCATACCAGCAGTGCCTTCAGGCCTCAACGTCACACTCTTGCCTGAGTTGTCCTTGAACGTGTACATTTCCTACCAAATATGCACATCA
CCGCACACTGTTGCATTAGTGCACTTTGTTCGTCTCCTCGCGCTTTGGTTTTCCTCTCACCTTCAAGACAATATCGGATCCATCTCCCAATGACCGCGAG
AACAAGTCCGTGTACTCCAACAGCGGCGTCTGAATCTGCAAGCAACCAATTGTCAGCTCACCCATGAATGTATCGCAGTGCACTACTGCGTCAGCACTTA
CCGATCGAAATCCATAGCGCTCCACTGTtttctgcagcacatggAGCACctctcgatgctgctgcgagtcGTCCGCCAGTAAGTCTCTCGTGCCTCTCAC
GCGGCTAACAGCCTTGGCTTTAGAGGCCACTGCcagccagcgacgcgtcTCGCCCGCCGTCcgccgcagcatcgtcagcCTCACAGTCGTCGGCAACTGT
CTGCCTAATTTCAGCGAATCAAATGCTGCTGGCTCATCTGCCCATAGTATTAAGGCTGTCTTACCTAAAGCGACGCCAGAAAGCATGaacgccgagcagc
agccaccagcagcggcgaacCCCCCGGAGCCAGCTGCTCCTCCCGTCGACGCCAAACTCGTGAGGCACACGCGTCGCTGCAATGGCCGCGACGTCTGCTC
GTGCATGTTGCGCGTGGAAAGCGCCTATTTCCAGAAGAATCTGGCAGGAAAagccgccgccaagaagcggcgaGTGGAGAGCAACAACCCCGTCAAGACG
CGAGGCAAATACAAGAAAGTGACCAATATTCAGCAGCTGAATTATGAGCTCAAGCTCTGTGTTGCAGCGTTCTTGGCGCCTGTGGCACTGGGGAACTTGG
GAATGGTGCGTCGTTGGAAGAGTGTGGGGGGGCAGTTGCATTGCCTTGCTGATGTGTGCTGTGGCCTGTTGACagaccaacaagaagttcaagcGCGACG
TGGAGGTTATGGCCAAGCAGGCGACTGGGGAGCTCCTGGCTGAGACGTCATCGGGCAAactgctgaagcagcagaaaccTAAAGCCAAGGAGTCCTGGTC
GCAGTTCATGCACAACCAGATGACGTGTGTACACAAGCTCTTCGTCTACTACACAGGCTACAAGACAGGGCCCATGAGGCAACAGTTCCCGCACTGGGCG
TTCGGGATTGTCTACGTGGACCCGAATGAGCCGCACAGGATCATACTGCCAAATACGTGGACATTCCATGGTCACAACCCGTGGATAAACCGTCGTGGTA
ATGGGAAAGATGGCGAGTGGCTGTTGACGAAGAAGTACGCGGCGAACAAAGCGCCCAAGGATTTCTTGGATCATGTGAAATCGTGGGCTAGCACGTTACG
GCCAGGGTCCATGCTAGCGATCGCAGTACGATGTTTACTGCAATATGCCAATTTCATTGTTGAATTCTTGCTAATGCTAATGCTTCGATGGTGCTATAGT
ATCAGAATGCTGGCTCACTGGAGCCGGCGTGGTGGGAAGCGCAAGCTTGGTATCTATGGCGTGGCGACGGCAAGCAGTGTGAGCATCCTTTATGCTGTGT
GTTTCGTGATAGCGCGTGAGTCTGACAGTCGTGTTTAAATGACTATGGCAGACCCTGCAGTTGTGTACGACCCCGAGACAGATACGCGCACACAGATTCA
CCCAGACGATCTAGTAGAGCATTTCAGGGTGAGTTTTCTTTCAACGGGTACCAGATGTGAAACTGGGCCGCGACTGACAAGCTTTCCGGAATGTTTTGAA
GGCACACCCTTTGCACGTTATCGACGTGTCCTCGAAACCGGGGGCGTTATGCCGGCGATGCGCTAGCCAGAACAGGACGTTCAAATACTGTCACGTGGAC
AAAGGCCACCCTATGTTGTAACCAAGCCAGTATTGGTGGaatgacggagaagaacaCGGAGGACTACAGTAGTTGACTTGTAAGCTCAGTCGATCCAGAG
TTTGACGAAATGACCTCATACCATTTGTCTATTCATCCTAccaaaaaataaaaaaactGCAGTGAGCTAATAAGCCTGACAACTACACGGCAATGACAGG
TTGTCTACGCGGTCCTGTAATCTTGGAGAGGCCAGCCTTGAAcaaactcttcttctccttggcatTTCCACGTCGGAAGCGCAGCACAAGCGGGCGCTTC
GCATCGTTCAGAGCCCATAATGTGTGCTTGAGACCAGCATGCTCGATATTAGCGTTGCCAATAGCAACAAGGCAATCACCCGGGTTTACAGCTGCCGCTT
GTCCCTGACTACGCCGCACAATAAGGCGTGGCGATCTCTTCACGCTGTCAATCTTGGGCGCCTACAAGCACAATAATAACACGATTGTTAGAGATGCACA
CTGCTGTAGAAAAATAATATAAAACATTGACAGCGCGTACCAACTGGAGACCAAGTGGGCCCTTGCGACGAATGGAGACTTCATATTCGTTCGCCTTGGC
AGTTCTCAGCGTCGAAACACTAACTACCCCCATGGCAACGATCTTGTATACACCAGTAATACTCGTGACCGCAGGATGCTCGGCAACCTCCTGCGTCGTA
ATCGTCTCATCTGCGGAAAACTcagtctcctcttcatcctcctcttcaacaGTGGCTTCACGCTCGACTTCAGTGATCTCACGGGCTCGACTGTAACCAC
GTCGCACAGATATTAGCTCATCAATTCAACTAAACTAAAGTGTGTTGGATCGAAACGTACGTTGTTGATCCTCTTCGAACCACACTTGAAGTTTTGTCTG
ACTTGGGCGCAGGTCTACAGAAAGAGCATCACGACACTCGTAAGTACAGACCCACCAGACCATTTCTCTCCATCAGTACTCACCTAGCCGAGCTGGTCAA
TTTCGTCGACTTCTTTGCTGATCGCGAACTCTTAAGCTCCTTTAGAACCAAGGTATTAACGCTGCCCATCGACACCGTAGTTCCGGTGTCCAAATTCTTG
ACGCATAAGTTGCTTTCAGCAACCGAGGCCGGCAGCTGAATGGGCGTCGGTTCATATTTCTCGTAAACGATACGATACAGCGACGGACGGTCCAGTGTCT
CCACATCAAGCGTGATCGTGCCCACATCACCAGGAGGGATACTGAAAGTCTTGGACACTTGCAGCCACAGCGCCACGTCCGAATTCATGTCAACAATGCG
GATACGGTCCAGAGGGCTGTGCCCAGCAGGAGCTTGGAACGTGATCTTTAAAGGTTTGCCAAGATCGCAGTTCTACAAGCAAGAAAAGTAAACAACGTTT
TCACAGTTAGGCCTCGTGCGTTGACATGAACCGCAGGTAAACTTCATCCACATACCGATTTGCACTTGACGCTGTACCCTGTCTTTTCAGCCTGGCGGCG
AAAGTCCTTCCAGGCAGCACACACATtttgctcgtgctgcagctgctctGTGTGTTGCAACAAACTTTTTGCTCGCGCCACCTTAGGAATGTTAAAATCT
TCAGGGCCGTATCCGTACGGGTTGAATTCAACACGAGCTCCGCGTCGAATGAGCTCCGCAGCCACGTCGTCCGCTCCGCTGGCGCTAAAGACACACAACC
ACCGTAAAATAGTTAGCTAAAACGTAGGAGGATCAGCTTTTCCTCACTCTTCGTACCAAGCGTAGTGGAGACAGTTCCAGCCTAGCTGGTCCTTGTGGTT
CATATCGCAGCCAGCATCTAGCAGGATAATCACAATGTGGAGGCGTGCATCGGTGTCACACTTGGACGCTAGCATGACGAGGTTGCGTTGGCGGCTGTCC
AGGTACTGCACCTGCACTCCACGCTCAATCGCGACCTTGACGCCTTCAACCGAGCCAATACGGATGGCGTGCAACAGTGTCTGGAGCAACGCCGCGTTCA
TAAGACGCGTAAGCTGCGAATTAGACTGCATAGCTCGCACTCTCCAACTCTTGGACGCCAACGGGACAAATGGACGGCGTGTAAGTGATGAACTGGACTC
GGCACTTCTggcagtagcagtagcaggTCGCGCCaacagcttctgctgctgtttctgcttCGACTCTTCCTTCCACGAGTCGTCACTGGGCGTTTCCAGC
TCTGGCTCGTCCTGCGTGGTGATGACAGCGGGTTTGTCCTCTTTACTCCGCTCCgtttcttctttctcctcctcctcttcagtcGCCGCCTTTTCCTTCA
AAAATCCCGTTTCTTCCTttgcaccagcttcttccgACTCGATCTCGGCTTCAACGCGGTCGCCGCTCTCACTCGAGGCACAGTAATTATCTTCCTGCTC
AATGGCCGAGTCGTACGCGCTCGTAGTGGACGTTTGGTCGCTCGCGCTTCGGCAGTTCTCGACGATGTCCAGACTGGGGGTTTTGCTCGCGACCGACGTG
GTCGTCTCGGGCTGAGAAGATGCCATCGGCACGCCAGAGGCTGCTCACCCACGAACCAGAACGGAAGGATCGACGGGCTTGTGGTGGCCGCCACACGGAA
GACACCAGACTGGCCCTGGCGGCTGGCGAGCGGTAGCGACCCCGACGCAATTTTTTACACGGTTTAGGAGTCAGAGCTGTTGACCCAGATGGGATAACGG
AAGCCTGCGAAAAACTGACAAACAGAATGGATACATGATCGGTGTTCACCAGGCAAATGTATTGCGTAGAAGACCTACGA