Description :
From Genome Similarity Track
Location :
Scaffold_48:202469- 205142
Sequence
2673 bases(100 bases per row)
AACTCCCACCGGATCGAGACGTACGGCATGAGATTGATCTCGTGCCTGGCACAAAGTATTGTGTCACGAGGTAATGGCTTGATGCCTTCTTCGCTGCGAA
AGCGAAGGCAAGCATGGTGCGGGAGTCGAAATCCCAGCACTCGATGCCAGCTTTCTGCGTTCGGAACCCGAACGGAAAGTGCCGTCTAGTTCATGCTTAT
AACAAGCTGAACAACGCGATGGTGCCGGCCCAAACACCAATCCCACGAAAGGACGTGTTGTTAAACAACATGGCAGGAAGCGTTCAGTAAAGTGCGCTGG
ATTTGGTAGACGGATACTACCAGATCTTGATGCGCGAGAGCGACATCCCACTCACCGCGGTGGGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCAT
GCCGCAGGGCTTGTCTAACACCCCGGCGACATTCAATAGCCTCGTGACGCAATTGTTCAGGCCACTGCGCGCCTTCGTACAGACGTACTTCGACGACATA
TTCGTCCATAGCCGTGCCGAGGGACGCAAGACGGCCATGGAGGTGCATCTGGGCACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAGCAGGCTTTACGT
CAACATCGACAAGTGCGTCTTCGCGTCATCAGAGATTAAGGTTCTCGGTTGCTTCGTAAGAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAGGGACA
TAGCAGCATGGACAACGCCCCGATTCCAGAAGGATCTTCGAAAAAGGTTGGGCTTGTCTAACTATCTTCACAAGTACAGTGCAGGGTATGGGGGCTTCGC
TAAGCCCTTGTCGGGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGCCTCCCAGAGGCT
CCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCGTCCAATTACGCCATCGGGTGTGCACTGCTGCAGGTCAACACGGCTG
GACATGAACGAGTCATCTCGTTCCAGTTCAGGCAGGTCAAAGCCGCCAAACGGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAATATTCCCT
TGTGAAGTTTCGTGTTCACCTTCAGGGCTCCCGGCCCTTCGTGATCTACACAGACCACGCATCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAA
AGGATGGCGAGGTGGCTGTCCTTCTTCGCTGAGTACAACTTCCGCGTCGAGTACAAGCCGGGCAAACTCAACGTGATTGCGGACGCCCTCAATCGGCGTC
CTGACTACAAGTTGGCCCACATCACACGGGTGACAGCGGATCTATATGAGCGGATATGCATGGCGTATCGAGACGATGAGGCTGTCGCGCCTATCGTCAA
GTTCCTCACGGCAGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGATGGCCTCCTCTATTAC
AGGGTGGAACCCTATGAACCTCCACGGATGGCCGTACCCAACGACGAGGATCTGAAGCTTGATATCCTCGCGGAGGCGCACAATGCGCCCTCCAGCCGCC
ACTTGGGTCGCGATAAGACCTTTCGGTCGGTCTCTCAGGCCTACAGGTGGGCCCACATGTATAAGTGGGTGGCACGATACGTGAAGACATTTGAAGCATG
TCAGCGGGTCAAACCTGCAGGGCACTCTTCGGCTCCACTACAAAGCCTGCCCGTACCGGCTGACTGTTAGAAGTTGATGAGTCTTGACTTCATATTTGGG
CTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGCCAGAGCAAGATGTACCATCTTGCTCCGGTTCCCGTCACTGTTACGGGCG
ACAAACCGGAAGGTTGCTCGTCGATAGGGTGTTCGCTATCACAGTCTCCCGGAGACGATTGGCTCGGACCGAGACCCGCGGTTCACGACTGCATTTTGAG
CAACGCTGTTTCCTTTACTTGGAACTCGTCTGCAGATGTTCACTGCGGATCATCCGCAGACAGACGGCCAGACAGAGCGCGTCAATCGAGTGCTCGAGGA
CACTCTGCGCAGTGTGTGCGCAGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGCGTTTGCGCTCAGCAACGCGGTGCACGCGTCCACGGGG
CTCACGCCGTTCTACTTGAACAGCTCCCGTCACCCCAGAGTGCCTCTCACGCTTCGAGGAGACACTGACTCCTCCATGCTAAGTGAGGGAGAGGCTCGGA
AAGCCCTTCCCCCCAACCCTTGGGTGTGAGACCAGTTTCGCAGCGGAAACAAGTGGAATCCGTTTTGGATACCAAGCTGAGCATTATCAGCAGGGTCCGC
GATGCAATAGCGGCGGCCCAGAATAGACAAAAGGAGTACTCCGACAAACATGGAAGAGGAAACTGAAGTGTATTTAAAGTGGGGGGGTTAGTGTTACTAG
CCACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGCATCAACAAGCTGAAGCACCGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGC
GTCGTACACCATCGCCCTCCCTAAGTCAATGACGGCGCACCCGACGTTCTATTTTGGACGCCTTAAGCGGTAC