Description :
From Genome Similarity Track
Location :
Scaffold_223:20246- 21776
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_223-snap-gene-0.19GRAM domain containing protein

Sequence
1530 bases(100 bases per row)
CGTCGATTTCAAAAAATTGACAATCAGACCAGCTTGGACGCGACACTGGTGCTTTCCACCGCGCGAAAACACCCACCGCGTCTCGATCTCAAAGTAATCG
CTAAATGGGATCTTGGTCATGCGGTGGATGTCCGAGATGATGAAGCGGTCCCAGCGTTCTCCACTCGTACTTGTAGATTTGTTCACGCGGAACCGCTGGA
CGCGGTTGCACGTCGCGTACGGCGGCAGCCCAGGAAACGTGATCTTCGGTGGATGCTGCGATGTCACCGTGCGGTGCAGCGTGTAGTCATTCTCCTTGGA
AATCACAAACCCTTTGTTGATTGCTTCAGTCTCGGCCGCTGGTGCGTCTGGGTCGATTGGTCGCCATTCCGAGATGCGGATGTCAATGTCACGCGCTCTC
TCCATCGTGCCATACAGGAATGACTGGCCGACGCCATCGTTCCAGAGCAGCTCAAACGCAGTTTTAATGTCCGTGCGCAGCTCGCAATCCAGCAGCACCG
TGGTTTTCGTTAGCGACACATCGGGCGGCAGCGGTTCAGAGGGCTCTTCGTCAATTGCACCCGATTTTGTGTCCTCTGCACATTGGTCCTCTTCGTCCTC
GAGAACTCGGCTTCGGCAACTCGAGTCAAGATTGCTGTCGTTGTCGTCCAGATCCGATTCGCGATCCATGTCAATGAACCCAACCGTCGACTTGCCCGAC
AAAAAGTTGTCCAGATCGTCTCGATTCGGTGGACTCAATAGCGACGTCGATTTTGGCAGCGCATCGGTGTCCGAGTCTGCAATCTCGCATTGCTGCGCGT
ACTCGTCGTCGCGTAGCTTTTTATACGATTTGCAGCGCACCGTCGCGTGCTGCACGAGGTCGTCAGCGTTCACCTGCACAACAAACTGCTTCTTGCCCTC
CTGATACGCGCGGATGAGCTGGTCCATGCGCAAGAAGCAGAGGTCGCGGAGTCCATTGAACTCGGCAAAGAAGAACTTTTCTTTGCGCCGCGTTTTCACC
TGGAGCGCGTTGATATAGTAAAACTGCGGCTTGATGAGCGACACGATCTTGGCAAACGGGATCTTGATCTTGTGGCCCTTATACCCTTTGAAGCAGAGGT
GCTCGCGCGTGAGGAACAGGTGGCCGTAGAACGGCGTAAAGTCCATAAACAGCGAGCAGTTGAAGATCGTCACGGGCTCCTCGTTCTCGTCCAGTTCAAA
CTCCTGGCGCACGACGTCATTCCCTGGTGGCTGATGGCCGCTCCACGTCACGTTCGTCGATTGCGCCTGGCTCTGGAAGTCCTTAATGCGGTGGTAGCAC
CCGTCGCACACGCGCTGCTCGCCGCGTGACAGGTACACTTGGAAGGGCACGACGATGGTTTTGCTCGAGCAATCAGAGCAGAACGAGCCACCGCAGTTCC
GGCAATGGTGGCGGCCCTTGCTCAGCAATGTGCCAATGTCTTCGCGGCAATTGTCGCACGCAAACATGTTGGCAAACGGTGGCGGCGGCAGCGTCGGATG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN