Description :
From Genome Similarity Track
Location :
Scaffold_2:202423- 204548
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G001106Similar to SPSB3: SPRY domain-containing SOCS box protein 3 (Bos taurus)
Pytul_DAOMBR144PYU1_G001105Similar to Peptide methionine sulfoxide reductase (Lactuca sativa)

Sequence
2125 bases(100 bases per row)
CAAAGTGCGTGTTTTTTCTTTCTTTTCTTTGTTCCGTTAGACTTGGTTTCAGTATGGCGCGTCTGATAACGGCAAGAATGCAGCGACTTCAGGTTTAGTT
TTCATTTTTTCTTCACTAACTTGCTTTCTTTCGCGTTATATTTCGGAAAGGAAACCGGGTGAATTAACTGCCTGTTTCAACGACAGGAGCAATGGTTAAT
TAACGCCTTCCTGACACTTTGATGGAAAAACTACGTGCAATATTACAAAGAAGATATATTTTGTGTGTGCTGGCGAAAGGGCAACAAGAACGCACTTCAA
CAACCGAACCCCTTTCCCCATTTCTGTTGACGACCGTACAAAACCCTTTAAGTACGATTTGCATTTCTTTCGACATTGCAGTAGAAAGCGACCCCACGCA
GAAGAAAGTTACCACAATTGCCAAAGAAGAACAAGAAGAAGAAAAGAACGAAGATGTTGCACGCCCAAGACGCGCCACCGCTGGTGTCGACGCCCTTCGG
CTATGGGGCGCTGCCCTCTGACGACCAGACAGCTGACGCGTCGCACGCGGATATCGATGCCGACTCATACGACGGCAACGGCGCTGCGTTCACGTGCGTG
CAGTTTCCGTGGGGACGCGCATACATGCACACGGAGCTGGTCGCGACCGAGCCCGTGTTTACGTTCTTCGCGCTGTCGAAGACCGAGCGCATGAAGTTTG
AGATGCCATTCGCGCTCACGAGCCCAGGATCCGATATGGTGGCTGCTGTACGGCGGAAGTTGGAGCTCGGCGAAGACATTGCGATCACATTGGTGCAAAC
AGATTCGATCAGTCGCCACGAGATCAAACCAGACATGGAGATTGGCAAGTGCACCATTGGCGCCGACTCAAAGCACCCGATTCTCGTACTGCAGGCGCCG
CGTGTGCGCTTTGATCCGAAGAAATGCTCGTACTACGTCGTGCTGCAGGAATCGAACAGCGTGGCGATCCAAGTTGCAAAAGGATTTGGCTCTGTTTTGG
GCAATTGCGAGGTGAATTGCGGCGTCAAATACTGGGAAGTGGAATTGCAAAGCGCAAGAGGCGGCGAGGGCGTGTTTCTCGGCGTTGCGTCGTCGGATCT
GCCGCTGAACGGCAGCATTTTGAATCGCGGCATCTTCTGGGGTATTTCCTGCGGTACTGGCCACAAGCTGCACGACATCATCGACTATTACACAGAGCCA
TTTGAGGACGGCGACGTGGTCGGCATGCTGCTAGACATGGAGTACGGCCGTCTCACCTTTTACAGGAACGGGAAGAACCTCGGCGTCGCGTATCGAAGCA
TCCCTGCGAAGCGGCTCTGCCCCGTGGTGTCGCTCACATTCGTGGGGCAGCGCGTCAAGTTGCTCTCCACAACGGTAGCGCCTCTGACGTAAAGCGAAAA
AGATTTTTAAACGCATGATGACGAGAAGCCGCGCATATTCATTTCTCTTTTTTTTATTGTTATTATTCAAGATGCCACTCCTTTGGAGCTCTTCATACTC
GCAGTCACAGTTGGATATTTGGTCTGTGGCAGTAGCCTCCACTTTTTGATGTGTGAGCAACATGAGTGTGGATTTCACCATGTGATCATTGCTGTCGCGT
CATTGGTGTTAAACTGTTTCTTTTTTTCCAATCACCTTTTTTTGGGACGATCTGGTGCAATACCGTGATGTGATTGGCGCTTTCTTGGACGCATGGACAG
CTGCGTCAACAACTCCTAACTGTAAACAGCGGTGTTGTGTACACAGACGCAAAGTGTGGTTGCGCTCTGCTGCGAACGAATCCCTTGTCATTCCGCAATC
TGCGCCGCTCCACACAACTCCACCCTCCCGTCTTCCTCGAAGAACTCCGTCAGCATGGGCATTGAGAATCAGACCGAGGCTAGCGTCGCGTACTTCGCCG
CCGGCTGCTTCTGGGGCGTCGAGCTCGCGTTCCAGCGCGTGCCGGGCGTGCTCCACACAACCGTGGGCTACGCGCAGGGCCACCAGGAGAACGCCACGTA
CAAGCAGGTGTGCTCGGGCAAGACGGGCCACGCCGAGACGATCAAAATCGAGTTCGACGCGAGTGAGGTGACGTATGCGCAGCTGCTCGACAAGTTCTGG
TCGATCCACGACCCCACGACGCTCA