Description :
From Genome Similarity Track
Location :
scaffold_43:202423- 204443
Sequence
2020 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGA
CTCAGCAAGATTCCTGCTTCTTGTCTCCCAATAGGTTGCACGCCTAATTACGTGAGAAACATGAGAGAAGCGTATGCAAATGGCCACGGAAAAGTCATCA
AGTTTGTGGAAGGACGCTATGGTGACATCGTGCACCGATTCTGCGCATCTAAAGGAAATGCACCGCCATTGTTGAGCTGTGAGCTGGTGAGTCCTTATAG
TATTGGTGGCGTGttgattcaaggtatgatctTATCcttggaatggcatggttgcaACACCATGACCAATGGATCggttggaggtcgaagaccttgggcg
ctacgcgcacatctCCTTGTGGAGCTATAGGGAGTCCTGAACCCACCTCCgctaggaggcaaaaacgctattggagcggtcactggaccgggacggtcaa
cgtgctggcgatcggagtatccaagtcgtcgaacaccgaaggtgtattagaCAGGAATCTCCCGAGCATGGATCGCGGGCTGAATGTGGACTggcactga
gcgctgctcatgtATCAAGGCAGTCGCTGCACTGCATGACACAAGCGGCACGGTCGGACGAGCtccgaggcatcttcggCAAGGCACTTCAGATGCGAGT
GAAGNNNNNNNNNNAGATGCACAGAAGCGGTGCACGGTGTCACCATAGCGTCCTTCCACAAACTTGATGATTTTTCCGTGGCCATTTGCATACACTTCTC
TCATGATTCTCACGTAATTAGGCGTGCAACCTATTGGGAGACAAGAAGCAGGAATCTTGCAGAGTTCATTTCGCACATAGTAATCATTTAAGGCGAGAAC
AGCACGTTTTAACGACGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAATCCTCGCATTCCAGAAATAATTGAGCCGTCATCTTTATATTTTTCGTTATTCTTACAAATAATAGG
GATGCCAAGATACGACTCCA