Description :
From Genome Similarity Track
Location :
Scaffold_99:202406- 204188
Sequence
1782 bases(100 bases per row)
TTGGTTGGTTTCGAGTCCCCTCTCTAAACGCTCGACTTCATCTCGCAGCTGCCGGACGCTTAGCTCAAGTTGCAGCTGGCGGGTTTGCTGTCTCCAGCGG
TAGCGAGCCTGTTGGCTTTACATTGCTCACGACGTCGGATGTTTTTGTCCTCCAGTGTCATTTTCCTCTTGTCTGCAGGCCGCAACTTGGCTGGACTTGT
ACGCTGGCTCAAGATGGACTCTTTCGTTCTGGTGACACGGCGAAGGCTCTGTCTGGCACTTGGGTTGTCGACCCGGGTACAGTCTATAGTTGGTGAAGCC
CCCAAGCTTGGTCCGAAGAACTGGCTTAGCAGCCTGCTGCTCGCTACGAGGTCGATGTGGGCCCGAGCATGACGCGCCCGACAAGGGCGTCCTCCAATTT
CCGGTGCTCAGGGCCGAATTGGTGGAAACGAGTCGTGTTGTTTCTAAAGGGGGGTTCCATCGTGTGAAACAGTATTCGTTGCGCGCGCTTGTGGGGTACG
TGGTGATACGAGTTATGAACTTGAGTTGTGAGCCATGAGCTCAGAGGGAGCCTTGGGGCAAGCCAATAATTCTCTCTGTGGCGAATAATCGCGGCAACTC
GTAGCCGCTGAGTACGGGCAGATCCAGTCCAATAAGCCTGCGACCATGATGACCACCTGCGCAACAGGAAAAAGTGGTTTACGATTCGGCACCGGCACCT
CATCACTGGCGAATCCTGCATGTATCAAAAGCTATCCGTGATTCTCTTGAATTCGTGTGCGTCTGACCTCATTTTTGTATCAAAACTTTTGCGTTTCCTG
CGCGCACACGAATTCTTTTTGCCCGCGACGACCTTTCCATACAAACTGCTGTTAAGCTGGTGGAAATGCAGAGTCGTTACGAATTCGTGTGCGTCAAACG
CACAGAAAAACTACTTTGAACCTCGAAACTCAATACCACACAGGCGCATAACAACCGCAGTTTATACAGCCACAAGTTCGAGGCGACAGGCAGTAGTGCG
TCGTCGCGCATTGCCTTTGCATAATGCAGCGTGAACCCGTGGCCAGGCAACCTGGCTACACCAGCGCCCATTAGGCTCCATATAACTCGTCCTCGTCCTC
GGCAACTGCATCAACGACGTGACGTAAGACGAGCTGAATTATCTTTTGCTTATATGCACGTGTGTTGGTGTTTCGACGCTAACCTACGCGTCTTGGCTCG
ATCTACGGCGATTTTCTCGAATCTCGTTCAATGCAGTAGACCATTTGAGCTGATCTTTGCGCCTTTGACGATTTTTTGGTGTTACATCGCTGATACGAAG
CTTCGGAATAGCGCCTTGAAGCATTTCGCGAGCCTGCTGCACAGTTGGGGTTGATATCCAGCAGCCTCGCGGAACTTTGGCTTGTATCTCCATCATTATA
CACCGATAGGCTGAGAGCGTCTTCCGCTTCCCACAAGTGGAAAGGTCCTGCCACTGCAGGAAGCGATATGGACCAATTCGCCCAGATGGGTCACCACAGC
ACCAGTGCTCCCAAGCACACCTTAACGACATGCTGGGAATAGTAAAATCAGCAGGTGCTCGCGTCAATCTTGAGTTCGTAAGAGTCAGGTTTTGTGTAGC
CATTTGGACTCCATCGTTATCATCTACATCTAGGCGGTCCTGAGATTCTTCTGTAGTGCAACCCAATGGCTGGGGTAAATGGCTTCGGACCGCTGCAACT
AGCTCAGCTATTCCACAGTCATTAAGCGCCCGCGATATACTGGCATTAAGCTCTGTTGACGACAAAGAAGATCGACAACGGG