Description :
From Genome Similarity Track
Location :
Scaffold_212:2024- 4843
Sequence
2819 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTGCTGTGTAACCCCGTCACAGAGATAGAGCTTATATAAAAAAATACAAACGCGGTATAATAAAACCGCCACACTTGGTAGCA
CTCGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGAAGTTCGTTGCCATGGACAGGAACGACTTCTCCCGTATGAACGACTCTCAGT
TCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAGCCTGGTGATGTCAACACCGGCTGAACTGCTCGAGCGCGTCAATGCGTT
CGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAG
GTTAAGCCGTATGAAGGGAAGGAAGGCGAGAGCCTTCACCTCTGGTTCCGAGAAGTAGAGCTCGCGATGGACGCGGCCCTGATCTCGACCGAGCAACTTA
TTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTGCTAAGAGCTGGGTGTACACATGGGAAGCAACGTCCCCTGGATGTTTCACATCCTGGGCTCAGCT
GTGTGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAGCATTCGCGCTTCCTCTCGTGTAAACAAGGGAGGCGTATACTGCACGAG
TACGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAGCCCACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCC
CCGCACGCATTCAGCTGTTCCGGGTGCAGTCAAGCACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCC
GACCGCAGCGTGGCCTAGGCGTTCCTTGTCGGCTCCCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATC
CGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCAAGCGCGACTGTCCCGCGGAAAGACTCCGCATACGGTCTTTCCCCAAGCCCGTCCTCAAGGGTCGCT
GGCAGAAGCCAGGATCTCGTGGACAGGGGAACGCCGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCATGATGGGTGCGCAGGT
GGCGCGTACCATGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGAT
ACGATCATCTCTTTCGAATCTTGATCGATTCTGGGGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAGCAGGAACAAGTTGTTCGATGCTTT
GAGAGAAAGCGAGGGCAACGGGACGGTGTCAGTGTGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAATGTCCAAGTGGATCTGGCCGTCAAGTTCGAA
GACTTTGACAGCCTCGAACAGTTCACTGTTCTTGATATGGATCCATATGATATGATTCTAGGCATGCCCTGGATTGAGAAGCACGAGCCCTGGATCTATC
GGCGAGGCGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCAATGGTGAGTCATGTTCCCGCCTCTGTCAGGACCCGGGGCGCCCGCAAGGGCTGCCAGGGT
ACCAAAGCATTCGGCAGATGCTTGGGAGTCGTCGACGTATATGACGGCTCCGAGGATGCTTTGATGGTGGCAGCGCCCAGAAGAGGCTCTGGCCAAGTGA
GTAACTTAGGTCCACAGGTGGGTAACTTAGTTCCGCAGACAGCTGCAGCTGTCATGAACACCGAGAACAGCGTGTTCAGAGTGGGTAACAGAGCTCCACT
CACGGTCGCCCAGACCTTAACTGACGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGACCAGACCTTAACTGAAGAG
GAAGGCGTCGAACACGCTTCCTGTGTGGGTACCACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTAGCGCCGACATCCCTAGACGGGAGCAGCA
AAGCCCCACGTCACGGTCGCCGTCGTCAACGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCAGATCGACGTCGCTTCAAGCGACTCGGAGTC
CAGGGCCCGGGCTCCTCCGACAAGGCCAGTTGAAAAGTGTTATCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGCATCTGGTGTCCACGTGGAA
CTGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGCTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAAATTGCTGAGATGGTGCTCA
TGAGACCTGAGACCACTCGGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACCTAAACAAGCAGCGTCAGACGCGCTTGGGCTC
TGAGATCCTTAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACTCACCGACCCAACTCCCACCGGATCGA
GGCGAACGGCATGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAAGGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCT
TCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAACTCCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTGGT
TCACACTTATAACAAGCTG