Description :
From Genome Similarity Track
Location :
Scaffold_620:20239- 21473
Transcript NameFunction/comments
Phypl_g9855hypothetical protein

Sequence
1234 bases(100 bases per row)
aattaaccctttcgcggtaAAAGGACAAATTTATCGCCCTTTTACTATATTCGCAAAACACGGTGTGAAAGTACGCCCTACAAGGGCACATTCTGTGCCC
TTTTAACTTTGAAGCCAGCCGGCGCTATTCTGCTTTTTTTCTACCAATCAGAATGGATGGTACAGGCGTGTGCGTAGATCTGGCTGGTAAATTATCGGGC
CACGTCGACAGAATCACTTGATTTATGGTCATAAACCGGGTATCCCCATCTTGTTGTTATCTCACCAAACCAGACCTCCCTCTTTCAGCCACTCAGTGCC
AGTCGTTTTGCCAATACAAACATTCAGATACATGCACCAGTCAGCGGCCGCAATGTCATAGTAAGTTCAAGTCACACGAACCTCTTCCTGTCCGTCTCCC
ATGCGCACCAACTTCCACGACTGGGAGGACAAACAGCTAGTCCAAATTGCGCTAGAGTTCGAGAACGAAGGGATACGAGTAACATGGGCGTACGTGACGC
GGCGCATGACGAGGTCGAAGCGGACAGCCCGCCAGCTCCGGTTGCGGCTTGCAAGTCTCAAGCGTACATACGGAAAGACACTGACACTGAAGAACTTCCC
TCGATGCTTTTTTAGTGAACCTACGCCAGGACAGCGCTTGCTTTCATTAGGGAGATGTCCACCTCGCGCTACGAATCACCGCTCACGACATCCTCTcccg
ccacctccagcaaagAAAGCAACGGTGCAGCAGTCACGACGGGGACTTTCGACCCCGCCAGcagtggggggggggcagtAGTGGAGGGGCCGGTCGGTGC
AgtggtggagctgtcggTCGAGGCAGTGGCGGAGGGAATGGTCGGTGCAGCGAAGAAACAATCGGCCGAGGCAGTGGCGGAGGGAATTGTCGGTGTAGCG
GTGGAGCAGTCGGTCGAGGCAGTGGCGGAAGGAATGGCCGGTGCACTGCTGGAGCAGTCCGTGGATGCTACAGCATTGCTCAAATTGCCTGACGTGATAC
GCGTTCTCGCGTCCATTTTTAGCGAAGTCACTGCCAATGACATTCGCCAGGAGGCAGGAAGAACGCAGAACAACGCGGGAGAGCAATTGCCGTCTGGTGT
CGCCGACATGCTTGCCGCGATGGATCCGCTGGACAAGCACGATGTGTTCCtggacgtcggcgctggaaTAGGCAACGTTCTGGCTCAAGTTGCGCTGACA
ACGAAGGTCAGCAGGTGCATCGGTGTTGAAGTCC