Description :
From Genome Similarity Track
Location :
Scaffold_60:2023- 8240
Transcript NameFunction/comments
g18468.t1RAW24142.1 hypothetical protein PC110_g19429, partial [Phytophthora cactorum
g18469.t1POM68377.1 Hypothetical protein PHPALM_15469 [Phytophthora palmivora var. palmivora
g18470.t1XP_009527712.1 hypothetical protein PHYSODRAFT_501310 [Phytophthora sojae
g18471.t1hypothetical protein

Sequence
6217 bases(100 bases per row)
ATGCACGTCCACCGGAGCCATCTTCTTGTAGTTCCTCATGTACTTCTTGGAACTCGTCATGTGCTGCGTCGCACCCGAGTCGACCAGCCACATGTCACTC
GGCTTGGCGGTACTGCTCGTACGACCAACCGAGAAAAGGTAGTCGCCAGGATCTTCTTCGTCCTGCGCGACGTTCGCACGCTGCGACCGATATCGCTCAG
CGTCGTTCTGGACCCGCGAGGGACACTCCGCGATCCAATGTCCTTGTTTGCCGCAGTTGTGGCACGCGCCGGTCTTCTTCACCGGTCGGCCCTTGCGCTT
GTTGTCTCTCGTCATGAACGCTTGACCTTGGCCGTGCGCGGCTCCGTCGACGCCGCCGCCACCTTGTTCCTTGCGCTTCATGTCCTCATGCAGCAGCCGA
GACGTCACGATTTCCCACGACAGCGAGTCGGCTCTCGACTCCAACGCCGTGATCAGGAACTGGTACGACTCGCTCAGACTGCCCAGAAGTGTGATCACCA
AGTCGTCCTCGCTGACCGGAGCGCCAACCGCGTCGAGCTGCTCCGCCAGCGTCTTGAGCTTGTTGATGTGCTCCAGCACATCATCACCTTCGTCCATCAT
CGTCGTGAAGAAACGCCGACGAAGAAAGAGCTTGTTGGCCAAACTCTTCTTCTCGAAGTGTCCTTCCAGTCTTGACCATGCATCATGCGCGTCCTTGGCC
GAGCGAACCAGCGGCAGCTGCGAGTCCTCCATCGCGAGACAGATGATCGCCAGCGCCTTACGCGACTTCCTCTTGAACGTCGCTTGATCCGCCGTGGTCG
TGCAGTGCTCCAGCTTCACTTCCCCACTCGTCACTTCCCACAGTTCGCGCTCCTCGAGCACCATCTGCATCTTGAACTTCCACGTGTGGAAGTTGGTTCC
GTTGAACTTGTTGATGCGGGCGGTCGTGGTCGGGGTGGCGTCCATGGCGAAGGCGTAGTCGGGGTCTTGGGCAGGGAAGACGGGTCTTGGGCTCATAACC
AAAAGGCTTTGGTCGGTTGATAGCAAAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACCTCTAAGCCTACTGGATTCTCTACT
GGATACACTCTACTGGATTCCTTACCGGATACTGAGTTGCTTCAGCCAATCAGTGACTGCCACGTGGATGCCCATCTTGTATCCACAATCTTGTACCCAC
GTGTCCCGTAATCCCCGTAGCGTAAACAGCGTCCCATCATCAGCGTCCCGTCAACACAGGAATGATTGCGGTCCCACTGAGTGAAGGTCATACCGGTATC
CTACCGGTATACGGCAGCTGCCCGAGGCGCCTTCTTGACAACAGTGATCATGGTGTTCCACCCAGATGGGACACGCGTGCCGTTCCGGAAGTGAACCAAG
AGATCTCGGAGGCGAGGCCAGTTCAAGTAGAGCTGCGAGTGGTCACTCAAGAAGTTCATCACATCGGCCACTTCCAGACGCGTCTGTCGAAGACGGTCGC
TCAGCATCTTGCGATGCGCTTCCGAGTCGTCCAGACGTCGGGTGAGTATGGCCACTTGTTCCTTGAGATGACGCTTGTCATCAGCATGCTCTTTCAGGAT
CTGGGTGATGTCTTCACGGGAACTTCGGACGACCTCGTCCTTTTCCGCCAGAACCTCGGCCACCTTCCGACTCCAATAGTCCGTCTGGAACTGGTAATCC
TGCTTTACCACCAGAAGTTCATCACGAGCTTCGACGGCGTCGTGGACAGCCGAACTGGAATCGTCCACTTGCTCTCGCATCCGACGATAACGAGCCATCA
CCTTCTGAAGGACATCCACTGTCCCAAAGACCCGCTGAGCCAAATTTTCCGGACCAAATTCGGTCAGAATGCTCGCGATCTCGCGCTTCAGACCAACGTG
ACTCAACTGGTGCTCCATGTCATCTTCCGAAAGTGGTTTCTTGCGGGGCGTCAAGACGTAATCGTGAATGTCCACATTTTCGTCGAAGAAATCATACAAC
TGCGCCAGAGAACCGATGGTCAACTCATTCATCTGCATCAGCGCCTCCAGACCACCATAGCCGTTCTGGGTGAACGTTTTCCCATCGTTGTGGCTTTCGG
TCGCTGGAACCCCAACGAGACGGACCTGTCTGCCAAAAGTGTGCTCTGGAGGGACTTCGTAACGCGCCGGTGCCGGCAACTGACGGTCGTGCGGGATGTC
GCGTCCAGAAGGAAGTGTGCTCTCGCCTTGGAGAGCAAGTGCTCGATCCAAAAGCAGTAACCGAGAGGGGGTCTGAGCCGACGATCGTCCCGAAGGTGCA
TCCATCGACTCATCCGCCGCGTCATCGGGAGCTTCCTCTTCTTCCGGAAGTTCCTCTTCCACCTCTTCCTCCTCGTCATCGACGGGCGGCGGAGTTTGGG
AAGGGACGCTTGGAGACTCGCCAGCGACATCACCCCCACTGGGGCTGCCGTCGCCAGGAGACGCCGAAGGCGTCTGCGCGGAGCTTGCGGGAGGACCTGA
AATGCCAGTGGGAGCCATGCTGGTGCTCACCAGGCGGGAGATTGCGATTTGATAGCGCTTCGACGACGTTGATTTCCGACCGCCAAGAAGTGATGTGATT
GGACGATCCGGGACAGGGCGAAGAAAGGAAGCGACCTCCGCCAGTTGAAGGACCAATCCGCCGTCCGGATGTGATTTCCGACCGGATACCCTGGTCAATT
TGGGCACGTGTGATCTCATCACAACCTGTCAGCTCGGGGGGAAAGCAAATTCCTCTATGAAAGCTTATGACGAGAGGGACGGTTGACACGTGGCGACTGG
ACGTAAAATGTCCGAGCGTCGTTTCCCATTTCCCATGGAAGCACTCGCGGTGATGATTGGTCCAGAAGTGCGCGCGACAGGGAAGAACGAGGAACGAACG
GAGAACTGGTACAAGTTCCCACAGCATACTGAGACCAAGTGACTTCCAGAAGTCCTCCCAATGTCGAGTTACTTCCGGAAGTCACGTGTGCCTTCCGAAA
GTTCCTTCCTGATGTGACTCGCAGATGACCCAGACGTTGTGGGTGCGGAGGCTGACCAGACGCTCCTGATTTGTACCCACCAAGACCTTTCCAATTTTCC
AGTATACAAAGCCCAAGATATTAGCGACCGACCAAGACGACCAGCCGGATATGTTATGCACGAAGAGCCGGCTTGCGACCAGGATGTGTCAGCCTCCCGG
ATGCTGATTACGCCAAAGAACCCTATAGTGAAACCAAGACAAATGTGCATGTGGAAGACTTCCAGCAGAGACCTTGACAGAAGACTTCTAGCAGAGACTA
AAAATAACAGAGAGTTCGTTTTGCCACCAAGGGCGCAAGTGTTTTCCAGGGCCCTTATCAGTTGGCCTGGAAGCACGCTGGGATAACGCCGGACAAGCCG
CCGTGTATTTCCGGGGACCCGGGTTCACCCAGCCTGCGTTTGGACGCGTCGTGATCGCGAAGACCGCCGTGGAACTCTCCGAAAGGCTCAAGACCAAATT
AGGCGGTGACCGAGTGACGCGCATTCGTACGTGATCTGTCCTATTTCATATTTCAGTTGGGAGTGTGTCCTCTAGACCCCCCATTTCATAGTAATTGCCC
TTTCAGGAGGTTGTTAGTAGTCACCCCCCGGAATTTGATCGAATAGACTGCTGTGTGATAGGACTGTATATTGAGTGATCCGGAAGTGGTTTTCCTTTTG
GATATATCTGAAAGTTATCTCCTGGAAGGAGTTATAAATCCTCCTTACTGGAAGTGGTGCGCAACAAGGGTGCATCTGGAAGTGACCAGTCTTCCAGGTG
AAACACAAGTAGACTGGTGTACGGACCCACTGCTCAAGGGTCCAAAAGAATAAGTAGCAGCTGTATATTGTGTATAACTCTCTGTATTATTTGGTCATCT
GGGAAGGCTTTGCTAGTGGTCTAACCCCAGCTGTACTAATTGCGTCGGGAAGTGAACGTACGCACTCTGTATTCTTGTATTCATTTTGATTGTGTAGGAA
CAACTCATCAGGTGGAGTCCGGTCTTCCGAAGACAAACGACACCTATAGGGATTACACAAGGTCACACGCCAAGCTACTTCCGGAAGTCCCGTACTTTTG
GAGGTAGTCTGACCCCATTGGGCTTTCCAAAAGGCGAAGTTTAAGCTTCCTGATCGGCCGAGTCTTCTGGCGCGCGTGCGCTATACACCCTGGACGATAA
AGGCGTTCACCCGCCTCGCCTCAATAGTCGCGCCTTTGATCCGATGACGGATCAAAGTGCAATCGCTTCGCAACGTCATCGTCAACGATGGCGTTGCACG
AATACAGCGCGTACGGATTCGGTGGCACGGTCGCACCGAATCGGCTGCTGATCTCAGACTGAGACGGCATCCATGGCTCGCGCACTGGCTCAGTGCGCGA
GGCCGCAACAACAGCGGATGGAGCAGAGTCATCTCCATCCCGCGGAGTCGTCAAGGCTCCAGCGGCAGCGAGCGGTGTTCCACTGCCGCTGCGCGAATGC
TTCGAGCTCGAAGCGTTCGAGTCGTCCTCGCGTGGACGACGCAGACCCACATTGGGGTCCGTGTGGCCCGGAGACAAGATGTCCTTGTCTCCTTCGAGTT
CCCCCTCCTCGACTTCGCTTCCATAGTCGAGGGGAACTCCCTCTCCACCCGGAGAGTAGATGCCCATGCCAGTCTCGACACCAATGATCTTGCCTGTCTT
GTTTCGGATGGCATGTTTCTCATGCCATCTCGAGTGGTATCCAGCAACAGAGAGGCGACTCTCTATTGCCGCGCTTGTCGACATCGCCGTCGAGGCGATG
TCAGTAGCGGTCGTGGCTGAGGCAGCGGCCGTCGTCGCCTTGGAGGCGACGACAGCACTTGCTGTTGCCGAAGCGGCCGGCGTCTTAGACGAAGACGTCG
TTGGCGTGCTCATTGGGAATGATCACGTGTTCTCCCGAAGAAAATACGGATTGCCGTGTCGAGACCGGCACGTCAAATCCTAACGGGGGGATGGTGTAGC
GGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGGATACATTCAGGTTGACCACTCCACAAGGTGGTCCACATTCATAGCCCAA
AGCATATGACTGGTAGAAAGTAACATATTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAAACCTCTCATTAGAA
ATATCAGTATTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTGCCACCAAAGCTATCGTTCGGTTCCTTTATCTAGGTTTAAGTATACTTGC
GGATACAAGTATACTGAACTTAAGCTAAATACACCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTAC
AACTTGAGCTGACCCATGTCCGTCATCTCGAAGCGGTGACTGAGCGCCTGATTGGTGTCGAGGAGCATCTTGTCGCTGCTGCTGGCGAGGACCAAGTCGT
CGACGTAGAGCGCCACGAAGATCATGTCTTGGCCGTCACGCTTCAGGTAGATGCAGTGGTCGGACTCGCACTTCTTGAACCCCAGCTTGAGCATGAAGTC
GTCGATGGTCTGGTTCCACATGCGCGGCGACTGCTTCAGTCCGTACAGCGACCGCTTGAGCTTGCACACGTGGTCCGGGTGGTCTTCGTCCACATAGCCA
TCCGGCTGTGCCATGTAGATGTCTTCGTCCAGCACACCGTTGAGGAACGCAGTCTTGACATCCATCTGGTGCAGCTTGAGACCATACTTGGCAGCCAGAC
TCAGTACGATCCGGATGGACGTGAACTTGGCCACTGGTGCGAAGGTCTCGTCGTAGTCGATGCCGTACTTCTGCGAAAACCCCTTGGCCACCAGTCGCGC
CTTGAACCGCTCAATCTCTCCAGCTTGGTTCTTGTGGCGAAGCGGGATCACGAAAATTGCTGTCGTGATCTCCGGCTTACCAGCGGTACGCCCGGACTGC
CGACTATCGGAGGGGGTACTCCGTTGATCTGGCGCGATCGGAACCTTGTATTCACCTTGTGTACCCGACGGCGGGGCGGGTTACGCTCTTCCGGTGTTCA
CTGAAGGCGTCGGTGGTTACCAGGATGGGGTGGGGAGCTGGACGGCTCCTTCCGGGGAACTGGGGGGTGACGTCTACGCGGGTATTCTTCACGCGGTCGT
CGGTGGTCTGCCGATCG