Description :
From Genome Similarity Track
Location :
Scaffold_613:2023- 4510
Sequence
2487 bases(100 bases per row)
TCCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAATCCATAATGATAGACTTCCCACCACCCCCGTGGTCACCAG
GTAAACTGGCGAGTGGCGCAGCCGAATGTGCTGAGGGTCTGACCCGGCTGGAACTTTTCGAATGTACGCAAATATGTGCTCCCCCCATTTGTAGAGTTTG
GGCCACCAGTAGTATTGACATACCCAGAGCTATCAGTCTTTTCCCCGTCCCCAAAATGCCCCACTGAGGGGCAGTATCATGGGGTCTCAAAAGAGGATTT
GATACTTTAACTACTTATTGTGAGGTTACCAACAATGCGAGCAGTATCCGCTATATCTGTGCGATAGCACAAGAGATCATTATCGATGGAATATCGATGT
AGGCTGGCCCGCAAGCGTGCCGATAATTGACTGTACTAGTCCTTGTATTTGTCACTCCCAAGGGCATTAAAAATGCCACACACTGAGAATCCCGTCGATA
TGCCACACGAATTCACTCCTCAATAGGAGACGACAAAGTCGTGACATAAGAAAGCTCATAATCAGGTCTGCGAGCGGAGCATCTGCCGACCCATTTTTTT
TGCCTGGCTTATACTTCACCTCGAAGTTATATTCTGCAAAGAAGGAACGCCAGCGAGCCATTCTCTGAGAGAAGTGAGGCGACTGTGTCGCCGGGCGTAA
TGACGCATGATCCGTACAGACGACGAATGTCTTGGAGCTAAGCAGATGGAATCTAAATTTGACGAGCGCATACTTCATAGCAAGTAGCTCTTTGTCATGA
ACTGGATAGTTCTCTTCAGCAGCTTTCAGATGACGAGATTCAAATGCGATAACTCGCTCGCGGCCTGCAGCATCTGTTTGTAACGGGGCGCTGTCTATAG
CAAAATCGGATGCATCGCAGACAACACTATAGGATACTCAGGATTTGGCAACGCCACAATGGGAGCATGGAGGAGACCCTCCTTGATTGCCCGAAATGCG
TCGGCATGGGTGTTGTCCCAACGCCAATCTGTGTCCTTCTTAAGGAGATCAGATAATGGCCGAGCCATATCAGCGTAATTTTCACTGTATTTGTGTAAGT
TACTGGCAAGACCAAGCCACTTACGCAAATCTTTTTTATTCTTAGGAGTCGGCCAGTCTACTATAGCCTTGACCTTAGCGGGATCCGCTTTAAGGCCGCA
CTTACCAATGAAACATCCTAGAAAAGGAATCTCCTCTGAACCAAAAGTGCATTTAGGCGCGTTGGTGTACAAATTAGTAGTGCACATGCACTCGAGCACG
GCCCGCAAATGACCGATGTGGTTGTCAACATCTGATCGACCTTCTTTGGCACGACTATGGACAAAAGTGTCATCAGAGTACGTCTGTGCGTAATCCCGAT
GTGGGCGGAAAAGTTGCATCACCAGAGGATTAAATGTTGCCGGATAATTAGACATCCCTTGGGGTATCACCATCCATTCTCACAGCATACCACTCGGGGT
GCTCACTGCTGTAAGCGGAATATCACTCGCTTGCATGAGCAATTGATAATATCCATCGACCAAGTCGAGTGCGCTATACATAGTACAACCAACCATGTTG
TTTTGAAGAACATCCTTTCGAGGAATGGGTGTCTGTGCCGATATCTTAGCCGCATTAAGATTGTTATAAGCATGCAATTACGCCACTTGGCGTTCGGCTT
TTTGACACAAAATGTCGGTGTCGAATGTGGAGATTTACTCTCACGTACCATTCCTGCCTCGTGCTTAGCACGGAAGAAGTCATCAATGACATCATATTTC
TCCTTAGGCAAGGGCCACTGTCGTATGACACAGTATTTCGTCCCAGGAACTAATTCAATTTCATGACGGACACCTCTATTTGGAGGT