Description :
From Genome Similarity Track
Location :
Scaffold_88:202180- 207205
Sequence
5025 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACATTCTACCTTAATTAGGTCACTTCGCTCTCTTTTGAATAAAGAGGGGCCATGTGAACTGCCGTTCACTGAGATTT
TGTATACTCTCGGACGCCAACTTTCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTAGTAGTCAATCCACGCCACCGCGGGTAGACT
ACCTGAACCTCTCCGAAGTTCGTTTCCATGGCTAGGAACGACTTCTCCCATATGAATGACTCACAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTCCG
GGATGGAGGCCCTGCAAAGGCTGATGGTGTCAACACCGGCCGATCATCTCGAGCGCGTCAATGCGTTTGACGCGTACGAGCAGTGGCGCATCGCGCATGT
GCGGGAGAACCTGCAAGCTCCGGCGGCGGAAGCAAAACCGCCACACCCGAAGCCAATACGGCTGAAGGCGTATGAAGGGAAGGAAGGTGAGAACCTTCAC
TTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCAAGCAAATTCGTGTTGCTTTTGCACTCTCCAACCATAGCAGTCGTGCTA
AGAGTTGGGTGTACACGCGGGAGGCAACATCCCATGAATGTTTCACATCCTGGGCTCAGCTGTGTGATCCGCTCCGAGCCGCGTTCCTCCCGGCGAACTA
CAAATTCCGCCAGCGCTCGCGCTTCCTCTCGTGCAAACAAGGGAGGCGTGAGTTGCACGAGTACGTGCAAGCGATACGGAGCTCACGGCGTCCCTAGTGG
TAAGCCCACTAAACGAACACATCATGATGACTGTGTTCATGGTCGGCCCTCGAGTGGGCCCCGCGCGCACTCAGCCGTTCCGAGTGCAGGCAAACACCCT
TGAAGAGGCGATTCAAGTGGCTCTTCAGGAGGAATACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCATGACCTGGGCGTTCTTTGTCGACTCCCGGT
CGAGCGAGCCCCAACGGACCAGTTCCCATAGAGCTCGGGTCCGCCGAGCAGCGTGACATTCGCTGCTTCGGATGCGGGAAGATGGGCCACTTCAAGCGCG
ACTGTCTCGCGAAAACACTCCGCAGACGGTCTTTCCCCAAGCTCGCCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCCGGAAA
CCAGTAGGGTCGGGGCGCCCTACTGGGGAAGAACTAGGGCTTCCTGAAGGGTGCGCGGGTGGCGCGTACCACGGGGATTTAGCCCCTGAGTGTCTTCGCA
CTCTCTAATCGGCGAAGAGCAGCGGCGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCACCCCTTTAGAATCTTGATCGATTCTGGGGCGTCG
AAGAATTTCGCACGCTGCCAGGCGGTTGCTCGTAATAGCAACAAGTTGACCGGTGCTTTGAAAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGG
CCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAGGACTCTAACAGCCTCGAACAGTTCACTGTTCTCGACATGGA
TCCCTACGATATGATCCTGGGCATGCCCCCTGGCTTGAGGAGCACGAGCCCTGGATCGATTGGCGAGGCAAGGCAAGGCAATTGGTGCTAGTCGCCCTGC
GAAGTCCGACAGAGCATTGGTGAGTCATGCTCCCACCTCCGTCAGGACCCAGGGCGCCCGTAAGGGTTGCCAGAGTACCAAAGCATCCAGCAGCTACTTG
GGAGTCGTCGACGTATATGACGACTCCGAGGATACTTTGATGGTGGCGGCGCCCCGAGGAGGCGATGGCCAAGTGGGAAACTTAGGTCCACAAGCGGGTA
ACTTAGTTCCGCAGACAGCTGCAGCTGTCACAAACACTGGTAATAGCGTGTTCAAGGTGGGTAACAGAGTTCCACACACGGTCGCCCAGACCTTAACTGA
TAGGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGGCGCTCCGACATCCCCAGACGTGGGT
AACAAAGCTCCACGTCACGGTTGCCGCCGTCAAAATACGGGTCTGAACTTCGTTCAGATCGACGTCGCTTCTAGCGACTCGGAGTCCAGGGCCCGGGCTT
CTCTGACAAGGCCGGTGGAAGAGTGTTATCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGAATCTGGTGTCCACTTGGAACCGTTGCCTGAGGT
TGCAGAGATACTGAACCTCGAGGAAATGACGGTCGAGTCTTTCCTGGTCAACCTCAAGGCTGGAAAGGTTGCCGAGATGGTACTCATAAGACCTGAGACC
ACTCGGGAGGAGCCAAACGCCTCATCTGTCTTGGACGAGGACGTCCTGGAAGACTTGAACAAGCAGCATCAGGCGTGCTTGGGTTACGAAATCCTAAAGA
ACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGATGAACAAACACCCACCGACCCAACTCCCACCAGATCGAGGCGTACGGCATTC
CTGTGTACTGTGTCACGAGGCAATGACCTCTTCCGCGCAAACAGTGCGAGGTCATTGATGCCTTCTTCGCTGCGAAAGCGAAGGAAGGCATGGTGCGGGA
GTCGAAGTCCCCGCACCCGACGCCAATATTCTGCGTTGGGAAGCCGAACGGAAAGTGGCGACTAGTTCATGCTTATAACAAGCTGAACAACGCGACGGTA
CCGGTCCAAACACTAATCCCACAAAAGGATATGTTGTTACACAACATGACCGGAGGCGTACTGCATAGTGCGCTGGATTCGGTAGACGGATACTACTAGA
TCCTGATGCGAGAGAGCGACATCCCGCTCACCACGGTGAGCACTCCAAGCGGCATGCTTTAGGAGTGGCTCGTCATGCCGCAGGGTCTGTCTAACGCCCC
GGCAACGTTCAGCCGCCTGGTGACGCAATTGTTCCGGCCATTATGTGCCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCAGGGGG
GGGGGGGGGGGCAATACGGCCATGGAGGTGCATCTGAGGCACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCGCTACGCCAACATCGACAAGT
GCGGCTTCGCGTCAACCAGAGACTACTGTTATATGTTGCTTCGTAAGCAACGTGGGCGTTCGGACCAACCCAGACAAGGTCATAGCCATAGTAGCATGGC
CAACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGGGCCT
CCTTCAGAACGATGTTGACTGGCGCTGGGAGCAAGAGCACCAGGATGCCTCTCACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCG
GACGAGACGAAGAAGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGAATTGCTGCAGGCCGACACGGCTGGAAACGAACGAGTCATCT
CGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAACGGAACTACCCTGTCCACGACAAGGATCTCCTGGCAATGAAGTATGCCCTTGTGAGGTTTCGTGTTCA
CCTTCTGGGCTCCCGGCCCTTCGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACAGATTCGCCTCACCCCTACCGAAGGATGGCGAGGTTGCTG
TCCTTCTTCACGGAGTACAACTTCCGCGTCGAGTACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGAGTCCTGACAACGAGTTGGATC
ACAGCACACGGGTGACAACGGATCTATATGATCGGATTCGCATGGCGTATTGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTCACGGCAGGAAC
GAGCGCGACCGACTAGCTCTCGTCGTGACAACGCTCACGGCTCCACCGATATGAGTTGAAGGATGGCCTCCTCTATTACCGGGTGGAGCCCAATGAACCC
CCAGGGGTGGTCGTACCCATCGACGAGGATCTGAAGTTCGATATCCTCGCGGAGGCGCACGACGCTCCCTCCAACGGCCACTTAGGCCGCGAGAAGACCT
TTCTGTCGGTTTCGCAGGCCTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATATGTGAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGG
CACGCTTCGGCTCCACTACAGAGCCTGCCCGTACCGACTGACTGTTGGAACTTGTTAAGTCTTGACTTTATCTTTGGGCTTCCCGCCGACGGACACGGCA
ACACCGGCATTTTGGTGCTCGTGTGTCGGCTGAGCAAGATGTACCATCTTGCTCCGGTTCCCGTCACTGTTACAGGCGAACAAACCAAAAGGTTGTTCGT
CGATGGCGTATTCCGCTATCACGGCCTCCAGGAGACGATTGGCTCGGACCGAGACCCTCAGTTCACTGCTGCATTTGGAAAACGCTGTTTCCTTTACTGG
GAACTCGTCTGCAGATGTCCACTGCGGACCATCCACAGACACATGGCCAGACAGAGCGCGTCAATCGAAGCTCAAGGACACTCTGCGCAGTGTGTGTGCG
GAAGCACCACATACGTGGTCGACGCAGCTTCCAGTTGCTGCGTTTGCGCTCAACAACGCGGTGCACGTGTTCACGAGGTTCACGCCGTTCTACTTATCCG
GCTTGCGTCACCCCAGCGTGCCTCTCACCCTTTGAGGAGACACTGACTCCTCTATTATAAGTGGGGGGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCG
GATGTGAGACCAGTTTCGTTGCGGGAAAAAGTGGAATCCTTTGTGGATACCAAGCTGAGCGTTGTCAGCAGGGTCCGCGATGCTATGGCGGCGGTCCAGG
ATAGCCAAAAGGAGTACTCGGACTG