Description :
From Genome Similarity Track
Location :
scaffold_9:2021229- 2026393
Transcript NameFunction/comments
Plaha_PHALS_02931thiamine pyrophosphokinase

Sequence
5164 bases(100 bases per row)
GCCTCGCTCAGTTATAGTAAATTGAGCCAGTCTTTGTACGCGTCGGCGAACGAGACGTATAGTAAATGTGATGATCAAACTCACGTAACGTGGTCTACAA
CGGCTGCGCAGAATCGAGCGGCACGTCGTGTACAGTCGCGATTTAAAGCTCACTTGCTGGAGTGTGAGATTGTGTTTCTTTATGACGACCTTCCTGACGT
CGACGAAGAGAACGAAACAGTGGAAGAAGACGATGAATCACTGGCCGAAAACCGTATTCATCGCGCTCCTGTCCAACACACGACATCCTTGCCATCGGTT
AATGGTTTAGAGCGCTTGGAACTTTCACTTAAAGACATCATTTGCTCTAGCTTGGTGTATTCACAATACTTCGTTACTGCACTTACTATAGGTAAGGTCA
CGTTGACCGAAAAGACGCTTCCGCGCATGCTGTTGGACACCAATGACGGGGAGACGGCGATGCTGTCGACGTGTGTTTTGGAGTTTGCTGACACGTCGCC
TTTTACCGGTCAAAAAGCTAGTTTATCGAAAAATGTGTCAGCTCAATTACGTATCGATTTCGAGCCGGCATCAGATGACATGACGCCATCGACAATCGCA
TCGCTTGGAGTGCGCGTGAATGTTCAACCGGTGTTATTTGAATGGGATATGTATCTGCTAGATCGAACACATCGTCTCCTCGCGCTTTTGGAACAAGATA
CGTCAGCGACGAAGCGAAATGTAGAATTGAcaagcaagaaaaatcaagctCAAGAGTTTGTTAAAGCACTCGATATGACAACAGATTGTGTTCAAATGAC
GCTGCGATTTCCCATGGTAAACAGCGATCTGATTCGCTTCGGTGTGTCGTCCAAGCGTGGTCTGTGTGAGGATCGAATTGTTCTGTCTATAAAGGGCATG
AACCTGGCATCGCATTCATCACAAGCTGGtgttgatgacgatgaggGTCGTTCTCCGATGCTTCCTCAGCACAGTAAACGCACTTCGCTGCCGTGGTTGG
CTGAGTTTGATGCTTCATTTGACACAATGCAAGTGGCCTTTTTGATTCCAGAGCTGGGCAATCAGCGAAGCCTTCATCTGGAAAAAGTGGTCCTTTTTGA
TGCTTGCAGTGATGAACGCCTGCAAGACGTTTGCACTCTTAAATTACGACTTCAGACGCCGTCGCGAGACGAAGTGAAAGAGGCAATTACTAGCAAACAA
AATCTGTCACAAGATTCAAGTCACAATCCCGATATTTTGTCTGAGGGTAATTTCTCCGATGAAGTTAGTGGAGATGACAACGATGGAGGAAGGGTAGGTT
TAAACGGCTGGAACCTTGATGCGCTGGGGCGTGTAGAGTCatttgaagcagcagcagcagaaGCATCCCTCTATTCCATGGAAGTTGGTCTTCCTCGGGC
TACTGCAATCTTGTATAAGTCCTCGCTCGACCGAATCATGGTGCTGTTTGAcgcgctcttgacgattaatCCAACTGATGTTGACATTCACAATGACGTA
CTCAATAAGGCTTTACACCGTAACCGTTTGACCCCTAATTTCATGAGTTTCAAGCTCATGCTAGGCGAAGGAGCTATCCAGATCCGCGACTATGTTGCAA
TCCCTGCTTTGCCTTTTAACGGCGCTAACCCAACTTCAGTCCGTGTGAATCAAAATGTGGCAACTGATCGGCAGAGTGATCTTGAAAAAGTTTTATTCAC
CTATCATTTCGTTTTTCAGTCATTGAAAATATTCCAAGTATCTCAGTGGATGGGACAATTGGTCTCTCGCGTTCACGTATCAGCTCAGAACACCACATTA
CTGGAGGAAAATGGCCGCACTAATGCAATTGTGCCAATTTTATACAAGACTCCGTTTGGAGATTCCAAAGCTCCAATCTTTTTCATGGGAGTTGACATCA
CAGACCAAACAAACGAAATGCGAGAAATGAATGTCGAATTGCACGTCTCGCATCTAACATTACGCTATGATGTGCACTCCAGGTGGATGATGCAACTGCT
TGAGATTCTTTTAATTGATTACCCAGTTCCGATCATTCCACTCGATTCGGCAACTTTGTCAAATGAGGAGAGTTTAGTATTTTCTGAATCTATCAAAAAT
GGAGGAGATTACGATGCAGTGCCCTTAGCAATCGATTCGAAAACTGTTTTTACGAAACTTTTTGTCAAATTTTACGACGTTCTGGTCGATTATGCGCCAG
TGTCGCTAACGTCACGGATGATTCTTTTGTTGGGCAAAGTTGACGTCTATTCCAATGTTGTCACAGGTGCTATTATGCAAGGCTACAAAATATCAATTGG
TGATTTGGAGCTTTTTATGACGCATGCGCATGCAGGCTACGAGGAAATCGATCAAATTCTTCTGGGTAATGAAATCTTTTTGCAGAACAATGCTAAAAGC
TCGATGAAGAAGGCAGTCAAATTTGCCGCAACATATGCTGTTAGTAGGGAGACATTAGGTGTTGAGTGTCCGTCGCTGTTAAAATTTTTAGAGACGTTTG
GCTTCTTGCAGCTTGTTACGATGGATTTTttggatatttttttgcgtGTGCTCGTTCAACCGACAGCAATCGAAGCTGCAACTGCATCACGGGATCAACT
GGAGCAGAAATTGTCAGCTGCGGCGGCATCACCAGAGTTGTCAGTGGAGCTTAACTTAGGCACCGCTAATATTTATGCGTGTTTTGACTCGTTCAATACG
TTGATCGAGCTGCTGTCGGTGTGGACCGATCAGCTTGCAATCAAACCAGAGCCACAAGATACAACTGCCTATGTAGGTATGGATGGAACGGGTGACATCT
CCAGTGTATCAGTGGTCACCAACTTAAATCATCTTCCTGCCAGTAGTGCATGGACAAATGGTTTAACTCTTTCAGAGCGATCTAATACACAAGGATTCTC
AACCTCGAGTAGTGTTTGTAGCGAACGACTCAGCATTGATAACAGCGAAAAGCTGAGACGGGATTCTTTCAATATTATGGAGCAAATCGATCAAGACGCA
TTTGGTAGCGGAAAGACGATTTTTCCTGGCAAGATTGTTGCTACAGACACTGAAGCGCGTTTATTACGAACTCGAATGAATTTGATTCAGAAAGAGAAGG
AGCGGATCGTACAGGGGCTTGATAATGAGCTGTCCGCTTCTGAGTTACGACTACGCTATCAATTAGAGGAACGACGAAAGTCGGTGATATCCGTCCCCAT
GAGCGAGCTTGTGATTGAAGACTATTATGCTCACAATCGCTCATTTGGCGAGTTTGATGGCGAGCCAGCTGGAGCTTTTTTGATGGAACCCCACGAAAAT
GCAGATCAAGATGATCCGTGGTTTGCGTCAAGCTCACATCCGCCAAGTCCTTCACAGTCTCCAGAGCAGACAGCAATGCCGTATAAGGAAGAAACAGTGC
GGTGGCTTCCACTTGACGGAGCCCGCATAGATTCTGGAATTAGAGGATCTACAAGTCCTATGTGTCGACCGTACGCTTCTGTGTTCGAGGCTATGGAAGA
CAAGGCGCCGATTCCCATGTCTGTACAGTTAACGCATAACAATGACAGACTGAATGATTACGAAGACAATGAAGTAGACGAATTTGAAGCCAATAAGGCT
TCATGTGGCGCATTTCCGGCGGCATCGAAAAATTTGTGGAAAATGCAGAGAAGGCATCACGACGTGGAAATGAGCGAAGGACAGACCGAAGAGACGGCCT
CATCGTTTTCACATCAATTGGATCTGATAGAGGGTAGCAGTGTGACTGAGGCAGACAGTGAAGGTATGGATGGCAGGAATGCTAATACTGGGCACCCAAC
ATCCATGTCTATGTCCTTTATCGACACAGGGGGAGACGAAGGTAAAGAAGTCAAATTGGAATTTGATTTGGATCAAGATCTTCAGTCGCAAATTAATCAA
ATGCTAAACGTGGATTTAAATGATGGCTACGAATTTAATGGTGATGAGAGTGATCAAGTGCGAGACGAGCAACGATCGAATGCTTCTTTCTCAGTACGAA
AGATGTCCTTTTCCTCGAATGGTAGCCATCCTGGTGCTCCCACGTCGTCGATAGGTCAACCTTCGATGTCTCCGCCAGACCAGCCAACAGCACGCTGGTT
CTATGACGAACAACGCTCGGACGATGGAAGTTTGCCGAATTTCGGCCCACCGTCGCGAATTTACCCACACCATGTTGAAATTCCGGTCGGTGGCTCAGCA
TCATCGTTATCATTTGGTGAAAAAGAGTGCAATGATGCCATACGATCGATTGCTCGGGAGAATGCTATGCGCAAAGTAGAAGCAACTCCGCCGATCGTTA
TTCAGCACGTTTTGCTGCGAAATTTCAACATTTGCATGCGATTTTTTGGCGGGTTCGACTGGACTCGTGATGCAAGCGAAGCAGTGAAGCTTTGCTCATT
TAGAGAGACTGATGCTGCAAAACAGTCaaaggataaaaaaattgacagTGCAACTGCAAAGGAAAAACTTTTAGACGCTTTATTAGACGACTATGTTCCG
TCCGGTGGTGGAGATCTCTTTGAAATCGATAGCAGCTCCGCCTTTTTTGGAGGAGCGAAGAGCGCACCGACAACGTCATTTATGACGCGCGACCCGGCAA
TGAGGTCAAGGGCAGCATCAAGTGACTTTATTCTCTCTCGTAAGCGTGCATTAAACAAAAGTGGACGGAAGACCGAGGAAATGCTCGAGTTGGTTGTCAC
TCGCATCCAGTTTCGTGTGGATATGTTTAATAAAGCCGAGACGCAGTCGTTGGCGTCTCATTCCTTTATAGCGCTAGGTGATCTCGAGCTTCTTGACTAT
ATTTCCACATCCCAAATTCGCAAGATTATCTGCTACTGGAAATCAGAAGCAACTCACCCACGTGAAAGTGGTAGTTCCATGGCACAAATGCAGTTAATTA
CTGTTCGACCGGGACCAAATCTATGCGAGGAGCACCGTCTGAAAGCGCGTTTGTTGCCGTTACGTATTAATCTTGATCAGGAAGTTGTTAAGTTTCTACG
GCAATTTGTGCCACCCAAAGAGATACCGACCCAATGTCAGCACCAACAGAGTATGGCCAACCTGGATGAGACGGAAGATGATGACAGCTCGTCGACACAT
GAGGATGGGAGGGAAATGATGGTAATGGGAGACACTGCAGCAACGAAGAGTGTGGGGGCATGGT