Description :
From Genome Similarity Track
Location :
Scaffold_1461:2021- 4674
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1461-fgenesh-gene-0.1Gene of unknown function

Sequence
2653 bases(100 bases per row)
NNNNNNNNNGTCCGCGTCACTGACGGGCACGGCGAGCGTCTCGGCCGTGTGGTCGTACTTTGAGAAGGACGCCATGGGCAACTCGGTCTGCAAGTTCTGC
GACCGCATGATCAAGGGCCACCACTCGTCCAACCTGCTCTCGCATCTNNNNNNNNNNGCGCACGGCCGGACGCACGGACCCGGCACACCAGCAGGCCAAC
AACGCCTGTGAGGAGCACCGCGAGAACAAGCGCGCCGTCAAGAAACAGAAGCTCGCGATGCCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGGAAACAGACCGCGAATCTGCCGTTTGGTGCTGCTGCTGCCTTCCAAGCAGCCA
GTGTGCCTGTGACGACGACAGCGGCCGCGTCCGTCTCGGCGGCCTTGACGAAAGATCANNNNNNNNNNCGCGACGGCATCTCGGCGTTTGGCTCGCACGC
GATTGCGCTGACTCAAGAGCAAATCACGCAGGACCTGGGTGCGTACGCCTTCATTTATGTAGTCTCTCGTCGGTATCTGCTCATCTTTACTTACGATTAT
TTTGCTTTGTGTGTGAATTTCGTAGCCCTCACAGCGCTTTTGGACAATTTGCCACTCAATTTTGCAACGAAACCTGGTTTCCAGTACTTTTTCCAGCAAT
TGCTCGGCGACAAGCGGTTCCCATGTCCAAGCGAAGACGCGATCGCAAAAAGCATCGTGATGCTGCACGAAAGCATGTTTCTCGCGACCAAAGAGCTTTT
GCAGAAGGCCAAATCGGTACGCAGCCAAACGCACTACTTTTCGTGTGGCACTCGTCCAATGTTTAACATTGTTTCTTTCATTTTTCTTCCATGCTTGTAG
GTTGGTGTGTCACTCGAGACGTGGAAATTTCCAGCCGTAGACGCGCCAAAGCCGAAACAGTACTTGGCGATCAAGGTCCACTTCAGCATCAACTTCCGCT
TGTACGACATCGTGCTAGGCTGTATCCCCATTGAGGAGATTATGAGCATCGACGGATTGAAGACCATTCTGGACCAGTACTTTGAGGTATGCGCATGGCT
CTGCAGCAAATAATCTTGATGGATTGTCTCCTGATGTAATGTTCCTGCATGGTTGAATCACATTTTTGTACTGCAGCGTGCGAATATCAAGGACAAGATC
ATCGCGCTTGTGAAAGACGATCTCCCACTCGTGGATCAAGACGGCAACACGTTTGCGGTCTCCGATATTCCGTCGCTTTTCGTTGGCGCGAATCTCGATG
CCCGCATTGGCTCTTCTTCTCACGCGCCGCAGGAAACTATTTTGATCAAGTCGGCGGTTGCGTATTTGCGTCAGTGCTTGACAAAGCGAGCTTTTGTCGA
CGCGTTCCCTGCGATCGTGCGTGCGTTCGAGTCGTTTATCGAGAGATTTACGAGCAACCGCGATGCGTTTGCGCAGTTCAAGGCCAAGCACCCGTTCTTC
GATTTGAAAGCCGGACTCATGGACACAGAATCATACTACGATTTCATCCGTGGCTTCCAGGATACGCTGTTGACGTTGGAGCAACTTGCGCACGATTACG
AGATCGAATTCGTCGACATCGCGGTCGTCGAGTGGATTGGCTTCATGGTCAAGAAGTTGCGTCCGTTCTTGCGGTACACAGACGCACTGGAGGGCGAGAA
GCGGAAGAAGACGGGGAGCGACAAGGAGGTCAACAAGAACGGACTCTCGAGTGTGTCGACGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTCACCGATGGACTAGCGCCACACATGGATCCACCGGCGTGGAAGCAGTTCTTTGAGCAACTGGCTCGCGAACTGCGGGATCAATTTGCA
GCGCTGCCTCCGATTTGCTACGCGGCGACTCTGTTTGACCCAAGATACAAGGACAAAGAGTATTGCTATGTGTCCTCCGACATCGAATGTGAAGTAGGAA
AATCGTACCTGCGTCGTTTGTTTGCATTCGTGCCGGACGACGAAGGTGCTGCGGCAGCAACGAACGCGGCAATCAAGGTGACCAGCGGTTCGTATGGCAT
GTCGGATCTGGACAAGGATGAGCTCAAAGGAGCGCTTCCGGTGACGTCGGACGATGTGATCCACGCTGGTGGCAGCGACGATACGCAGGACGATGAAGAC
GAAGACCTACTTGCGCATTTGCCATCGGGTTCGAAGGACAGTATGCAAGCGGACAACGAGTACGTCGTGACGTGGCAAAAGGAGCTGAGTGCATATTTGA
CGCTTCCTGTGGCCGACCGCAACGTGGATCCGTTGGGCTGGTGGAAAGCTAATCAATTGCGGTTCCCGTTGATCGCTCCTTATGCCGAGATTGTGCTGTC
GCTGCCAGCGGCCTCGTCGAGTGGGGAAAGTGTTCGCACTGACATTCGTCGCGTGCTGCTTCGCACTGAAGGTGTTGCGTATGAACCTGCACTCGTGAGC
TACCCGTCGCTGATCGAGGCGTTCCTGTGCTTCCAGAAGAACAAAGAGTACGCCATGGACTGGTTCCGCAGCAGTAACCCCGACACTATTGCGGCATCGC
TGAGCTCAGACATCGACAACACGAACGTACCCAACAGCTTTAAGCACATCGAA