Description :
From Genome Similarity Track
Location :
scaffold_347:2021- 4357
Transcript NameFunction/comments
g7501.t1 hypothetical protein PHYSODRAFT_506679
g7502.t1 hypothetical protein PHYSODRAFT_506679

Sequence
2336 bases(100 bases per row)
TATCCCACGTCGTGAACATCGTCACGATAAAATCCAGGACTGTCACCGACACAATGGTGATCCCGTGCATCTTGCGCCAGTTCCAACGCAGTCCGTACTT
GCCAGTGCAATAAAGCGCGACGGCGAACATCCCGTTGCTTAGGATAGCCATGATCTTCTGGTTTAAAGGAGTCACCTCCGCCCAGTAGCGTTGCATTGGG
TCCGAACACGTGATTGTAAAGTTCTCGAAGATACCGGCCAAGTATTTGTACGCGATCACTTGGTACATGGGGCGTAGCTGGATCAGGTACCAAAGTTCCG
CCAGATAATCTCGGAAAATCACTCCTGGATGACGGGTTTCCTTGATACAGTACCACGAAAGCGGGATAACTGGGAAGCAACAAGCGCTGAGGACAGCCAT
CAGCTGTGGAAAGCTCAGGCAGAAGTCGAAGTCCCCTCCGTAATGTCTTCCGTTGAAAGCCAAACCAGTTAGGATGCTGGAGACCATGACAAACGCTGTA
CGGATCATATAAATCGTCGTCTGCGTGTAACCCCGAATAGCTTCTGGCTCGCGTTGGGCGACTTCCACCATCACCGCATCAGCCGCCACGTCAGCACAGA
CGTAGCCGATAGCTGCGATCATCATGAGGACAATAAACTTGCCGCCTGCGTGGTGTGCGGACTCGTTGAAAGTCGCGAGGATCTCGGGGGTTAACTCTTC
CTTTTCCAACGTCGCGTACTTGTTATCCGGGTAGTATGGAGCGCCCGAGTCCATGCAGGCCATAACCACCAACGTCACGAAGCAAAGGGTCCACCCGATA
ACCATGAACGGACGACGTCTGTAGCCTCCAATGGGAACGCAGTCCGTGATCATACCGAAGAAAAGCTTGAACGACCACGGCATGTTAATCAACACCGTGG
CGGACACGACCTGGGTGCCTTCCATGTTGAGGTAGTTGAATAAAAATGGGTAAACTGTTCCAGGAAGCGTCCCGAAGATCATCCCCACTGCTGCATACTG
AGCAATGAGACCGATGTACTCGCGACTCCAAATGTTCACCTGTCCACCGGCTCGTAGAGCGCCTCCGTCGTACAGCTGCGGCGATTTAGAGTCAAGAAAC
CAGTCATTATCCTTCCTGGGTGAGAAGTTGGTGGCCGATAAAGCTGGGGCCAGCAAGTCGATCTTCTTGCGCGGCGTCGGGCGCATTCGTTCTTCGAGTA
TCGGCACTATGATTGCGGTTAGTACAGAGAAAGCGAAAATGACGAATAGGTAGGTGAATTTATCGCAGAGAAAGCGAAAATGACAAATACCGGTAGTTAG
GTTAATCACAGCAGTAGCGTTACATGTACGGGAAACCAACTGAAGGAAAACCTCCGCCACGACTCGAAAGACATTTGGGACCAAGAAACGATGGGGAGTT
GTGCAGAACCAAGGATTGTAGTGGTCTCCAATACGAATCGAAGGTCAATTTGTACGGATTGAGTTCACTGTCGTATGTTGCCCCGCGTTCCGAATATGTG
CTGGCATGCCCACTGTCAGTTAATCAAAGCGTTTATTAAAACGCTATCGAAGACTAAAATTCGGTTCAGATAATTGACTCTGATGCTAAGAGAGAACTCG
AGGTTGACATTGCTTCCTACAGAACATGTATTCAAGTTTGCCCTTCCATCGCTCTGCAATTGAGATCGAGATAGCGGTGATAGTACATGTATCACTGATA
CAGGCTCCTCACAAATACGCAACTTGCGTAACGCAAGCGAGAAAATCCCAAAAGACTTGCGATCCTCGTCCGATTGCAATTTTGAAACGATATCAGCTGG
CAAGACAAATCCAAAAGTTTACGGGCAAGTTGAATCATAAATATTTCGGTAGTTGGGGATATAAATCCCGGGTATTCCAGACTTGAACACTTCATACAAT
TACACCTTAAAAACTACACACAAATAACCCTTACAAATGGCGATGCTGTTCACTAGCATCACACCCGTCTCCTCCGGCGATCCGAAGGCACGATGTCGAC
GGGTAAATGCTCAAAATATTCGCCATCACTGTCCAGCAGAGCGAAAAACCAAAGTAGAAAATCGTGAGAAGACCCATAAATCGACTTGATCCTCCAATTT
GCTTTAGCTGTTGCGTCTCCGCTTTCTGACGAGGCAGCAGCGGCAGGAACAAGAGCCCCGAGAGATTCACAGCGTACCGAATAAGCAGCACATAAGTCAC
CTCCCACCGCACGTGGTTACTGTCCTCGACAATATCTTCGTTCGCAACGTCGAAGTTACTCCCCACGTTTTTGGTCAATGTGCTGGCCAACGGGATCGCG
ATGTTGGAGATCGATCCTACCAGACCGTATACGGCC