Description :
From Genome Similarity Track
Location :
Scaffold_64:20207- 23555
Transcript NameFunction/comments
g9774.t1hypothetical protein

Sequence
3348 bases(100 bases per row)
GGAGATCGGCTGGTTCGACGTGAACGAACCGATGCAGTTGGGTTCGCGAGTCGCAGAAGCGACGGTGACAATCCAGGAAGGCATGGGTCGCAAAGTCGGC
GACGGTCTCAATTTCTTCTCCATGGCTGTCTCCGGTCTCACCATCGGCCTGATCAAAGGCTGGGAACTAGCGTTGATCTTGCTGGCCTTCACCCCGTTCA
TCGCGTTCACGGCCTTCTTGGCCATGAAGGTCTTGTCCACAGCTACTCAGGCGGGGTTGGAGTCGTACGGCAAAGCTGGTGCCGTGGCGCAGGAGGCTCT
GAGCAACGTCCGCACGGTGCACATGTTCAACTCGATTGACCACTTCGTAGCCAAGTATGAGTCAGCGCTGGGTCTGTCGACACAGGCTGGCATCAAGAAG
GGGCTCGCCGTCGGGTGGGGTACGGGGCTTATGTTTGGGACGGTATTCTGCACATACGCAGGTGGGATGTACTTTGGCGCGCTCATGGTGGCTAACGACA
ATCTGGACGGCAACACATGCGATCACTACGGATGCTACGATGGCGGGCGAGTGCTCACGGTCTTCTTTGCTGTTATCATGGGAGCTATGGCGCTCGGCCA
GGCTGCTCCCAGTGCCGAGGCGATCACTTCGGCTCGTGCTGCAGCGTTCCCCGTGTTCCAGACCATCAAGCGTCCGTCACTGATTGACCCGCTGAGTGAA
GACGGCAAGAAGTTGGACAAGGTCATGGGTCGTATTCAGATTGAGAACGTCTCCTTCGCCTACCCTTCACGCCCCGAGATTCACGTTTGCAGCAATTACT
CGTTGACAATCGAGCCTGGTGAGACGGTGGCGCTTGTTGGCCCCAGTGGCAGCGGTAAAAGTACGATGGTGTCGCTTCTCGAGCGCTTTTACGACCCGCT
TAACGGATCGGTAAGCATCGACGGTGTGGATGTGCGGACACTGAACGTGAAGTGGCTTCGTTCCCAGGTCGGACTGGTTGGCCAAGAGCCTTCACTTTTT
GCTACGTCTATTATGGAGAACATTCGCTATGGTTGCCCCTCGGCGACGGACGATCAAGTAATCGAAGCTTCCAAAATGGCCAATGCGTACAACTTCATCA
AGGAATTCCCCCAAGGCTTTCAAACGGAGGTGGGCGAGCGTGGTGCGCAGCTTTCTGGCGGGCAGAAGCAGCGGATTGCCATCGCCCGTGCGATCATCAA
GAACCCGGCTATTCTGCTACTTGACGAAGCGACGAGTGCTCTTGACACCGAGAGCGAGCGCATCGTGCAAGCTTCACTGGACCAACTTCTCGCCAACTCA
CACCGAACTACGGTCATCATTGCCCACCGACTGTCGACCATCCGTAACGCGAATCGCATCGCTGTGCACAGCGGTGGTGCCATCGTGGAAATTGGCTCGC
ACGACGAATTGATGAAATTGGAAAATGGTCACTACCGTCTCCTGGTTGAAGCCCAGAACCGCGTTGCGATCGAGGAGAAAGAAGAAGGCACTAGTGATGT
AATGACGGTCGAAGACCTTGAGTCCCCTGATGACCACAACGTTCGCTCTGGTCGGTCCACTCGACGGTCGATTAGCCGACACAGCGTGTCTGAGAAGGAA
GGTGCTGCTCCGATCGATGATCTTGAATTGGGTGATGCCAACCTTCCTCCATTCTCAATGGCTCGAGTCTGGAAGATGTCGCTTCCTGAATGGAAGTTTT
TGGTCGCTGGTTCCCTCGGCGCTATGATAAATGCGGCCGTGTTTCCGGTGTGGGGTGTTATTCTAGTGAAGGTCACGGTGCTCTTTTTCCGGCTCGACTA
CACGAAGAGTGAGATGCTCGATCACGCGCGTTGGTGGTCTCTAGGCTTCGTTGGTCTGGGAATCACGTTCGCTCTATCCATGACGATGCAACACTATGGT
TTCGCGGTTGTCTCGCAGAAACTCGTTACCCGAGTGCGTTTGTCCACGTTCAATGCGATGCTGCACCAGGAGATCGGTTGGTTCGACTTGGATGAGAACT
CGTCCGGTGCGTTAGTGTCTCGGTTGGCCACGGACTCGGCGGTGCTGCAGGCCATGACCTCGGAAACACTGAACAGAGGGTTGGTGAACATCACCACGCT
CACGATCGCTTTCGCAATCGCGTTCTTCTACAGTTGGCAAATGACGCTCATTTTGCTGGCAGCCTTCCCAGTGCTTGTGCTGTCTTCATATGTCCAAGCC
CAGCAAATGGCCGGCACGTCGGGCAACAAGAAGAACAATGACGCGGATACAGCAGCAGGGTCGTTGCTGTCGGAGGCAATTGGGTCCATTCGAACGGTGG
CCTCGTTCAGCATGGAGGTGGCTCTGAACTCGTTGTACGTGGGCTACCTAAGCGTCTCAAAGGAAGCCGACATCAAAATCGGCATTGTCGGAGGCATGGC
ATTTGGTGTATCGCAGGGAGCGATGTTCTTGGTCTTGGCGTTCCTCTTCTTCGTCAGCGGACGTTGGATCTCACGCGGAATCATCACATTCGAGGAGTTT
TTCATGGTGCTCATGGTGATCATGCTCAGCACGTTTGCTATGGGTATGGCTGCACAAGGCGCCTCGGATGGAGCGAAGGCCAGACGCTCAGCCCAGCGTG
TGTTCAAGGTTATCGATCGGAAGCCGTTGATCGACGCTACCTCTGGCACGGGCCGCTCACTGGATCACGTGGACGGCGATATCGAGTTCTGCAACCTGCA
GTTCTCGTACCCGGCTCGACCAGATGCCAAGATCTACAAGAAGTACAACTTGAAGATAGCACGCGGCCAGACTGTTGCGCTTGTCGGTGCCAGTGGTAGT
GGCAAAAGCACGGCGATCTCGCTGATGGAGCGATTCTACGACCCTTCTGCCGGCGTGGTGACGCTGGACGGGAACAACCTCAAGGAGCTGAACCTGAAGT
GGCTGCGTGAGCATGTATCTCTCGTGAGTCAGGAGCCCGTGCTGTTCGCTGGCACCATCGCGGAGAACATCGAGCTCGGAAAGCCCGGGTCGACTCGTGA
GGAGATCATTGAGGCTGCTAAGAAGGCGAACGCGTTCGACTTCATCAGCAACTTCCCGAACGGATTTGATACGGACGTTGGCGACCGCGGTGCGCAGGTT
TCAGGCGGTCAGAAGCAGCGTATCGCCATTGCCCGCGCCATCTTGCGCGACCCGGCCGTGCTGCTGCTAGACGAGGCGACCAGCGCGCTGGACAACGAAA
GCGAGCGAGTGGTGCAGGCATCTCTAGATCGGTTGCTGGCGCTCAAGCAACGCACTACTATCATCGTGGCACATCGCCTGTCCACCATCCGCAACGCGAA
CCTCATCGCCGTGACCCATGACGGTGCCATCGTTGAGCAGGGTACGCA