Description :
From Genome Similarity Track
Location :
contig_36:202056- 204066
Transcript NameFunction/comments
g8770.t1hypothetical protein

Sequence
2010 bases(100 bases per row)
TTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGATAAAACCTGTCGACACGACCGCGTCGCTCCGGACGCTTCGAGACCC
TCTCGAATCCGATCGAATCAGGCCCTGCTGATTCGGTTCACATTTCCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTCGGGGTGATCCGAGACAGCC
GCATTCCGCGCTGTCTTTGGTGAAGGGCCGCATGCATCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGA
AGTGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGAC
GATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCATACGGGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCC
AATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAA
GAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCAGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTTTCACTGGGGGTAGCGATCTT
CATTGCAGCGTGTCCGATGTCGACACGCTCGACCGCATCACCAGCAGGACTCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGTTAGACCGTGACGATACC
CAGTATCGCCACGACGGCTTCTCGCCGTGTGCACATGTGCTGTGCACTCGCGAGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGA
TCCACGGTGCTGCTGGGAACCAGCAGTCGTCGCACTCGAGAGGTTCATTGGTTCGGGACCTCCCGACGGCCTTACCACCGGTCGTGGCATCAGTCGCGGG
ACGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCGAGCGCAATTGCATCCTCGAGAGTTTGGATACTCTCGGAAGAAATAGGTC
TTCACAGGCCCATCTCTAAGGCCCTTCATGAACATGACGACCTTTGTCGCCTCATCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCCCTTT
GGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTTGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTC
CACCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGGTCCGTGAGTCGGCGTCCGTCCGCCCAACTCCTTGCTCGTCCGCCAAGACATGACATGGCGAAC
GCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTCCCCCCTCTCTTCCAACGTAGC
TACTTACGTGGAGTTTCAATGACTCCCCGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAG
AGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGCCTCCCACTCTGGTTCCGACAG
GTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGTGTTCGTAT
TCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCA
CGTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCGCAAGTTACTTAAACCTAGATAAAGGGACCGAACGATAGCTTTGGTG
CCAAATGAGA