Description :
From Genome Similarity Track
Location :
contig_15:202050- 203954
Transcript NameFunction/comments
g3377.t1hypothetical protein F441_15031

Sequence
1904 bases(100 bases per row)
GGGCTGGACCACCGCCGAGATGCGTGCCTTCGTTGGTCGCATCCAGGAGATCGCCATGGAGGAGAACGGCGGCCACCCGATGATCTACGGCACGGACGCT
GCTCACGGCAACGCCATGATGATGGACACCGTGTACTTCGGTCAGCAGATCAACGCCGCCGCCACGTTCAACCCGGACCTGGTCTACGAGCAGGGCCGCA
TCACCGCTCGTGATACGCTGGCGTCGGGTATCCCATGGATCTTCGACCCAGTGCTCGACATCATGCACAACCCGCTGTGGCCGCGTGTGTACGAGACGTT
CGGCGAGGACCCGCACCTTGCTTCGATTATGGGTGCTGCCATCACTCGCGGCATCCAGAGCTACCCGGAGGCTGCGGCGTGCATGAAGCACTGGATCGCC
TACGCGTGGAACCCGACTGGACACGATAAGGACGGCGTGGAAATCTCGGACTTCGACCTGCTGAACACGTACTTCCCGTCGTTCAAGGCCGCTGTGGACG
CAGGTCTGTTGACCGGTATGGAGAACTACATCTCGGTCAACGGGGTTCCTGTGATCGAGAACACGAAGCTGATGACGAAGCTTCTGCGTAATGATCTGCA
GTTCGAGGGTCTGATGGTGACGGACTACGCCGAGATCAACCACCTGACCGAGTTCCACCGCACGGCTCGGTCTACCGACGAGGCCACCAAGTTCGCTCTG
GAGCGCACATCGATCGATATGAGCATGGTTGCCGGTGATCTTTCGTTCACGAACGCCACGAACAAGCTGATCGAGGAGGACCCAGCGATCGTGGACCGCA
TTAAGGAGTCCGTGCGCCGAATCATCAAGACCAAGCTCAAACTCGGACTGTACGACAACCCGCTCCCGGGCGCCGAGTACCTCGACTTGGTTGCAACGAC
GACGACGTCGCCACTGCTCTTGACCTGGCTCGCGAGTCGACGGTTCTGCTGCAAAACAACGACACACTGCCTATCTCCAAAACCGCGTCGGTCTTCCTGA
CGGGTCCCAACGCCCACAACATCGGTCGTCAGTGTGGAGGCTGGACCGTTCAGGCCCAGGGTGTGTCCGGCAACGACATGTTCTCGCACGGCGTGTCGGT
GAAGCAGGGTTTCGAAGCCATCGCGGGCAGCGATGCTTTCACGTATTTCAACGGCCTGAACATCACCGGCAACTACACGGCTACTGACCTGGCCACCGCC
AAGGAGTACGCTACCAAGGCCGAGTACACGGTGGCTGTCATTGGTGAGGAGGTGTACGAAGAGAAGACTGGTGACATCAACGACCTGACCCTGCCTCTTG
GTCAGATTGAGTATGTGAAGGAACTTGCTTCCACGGGAACCAAGGTGATCCTCGTCCTGTTCGAGGGTCGTCCGCGTATCCTGAACGACCTCCCCGAGAA
CGTGTACGCCGTCCTGAACGGCATGCTGTCCTGCGAGCAAGGTGGCAAGGCTGTCGCTGAGATCATCTACGGCGACGTCAACCCCAGCGGACGCATGCCT
ATCACTTACCCCAAGGACACTGGCAACGTCATGATCCCGTACCGTCACCGCGTGAGCACCCAGTGCGCCTCGGGCGATTACTGCGAGCCGCAGTGGATCT
TCGGTCACGGTCTCAGCTACACCGACTTCACGTACTCCGACATGAACATCAGCACCGCCAACGTCACGTCCAGCTCCGACTCCGTCAACGTGTCGGTGAC
CGTCACGAACTCCGGCAGCGTGGCCGGCAAGGAGACCGTGATGCTGTTCCTGACGCAGCCGTACCGCTCCATCTCGGTGCCCGAGGTGAAGCAGCTGAAG
AAGTTCTCGAAGATCAGCCTGGAGGCGGGTGCGTCGCAGACGGTGTCGTTCGAGCTGACAGCGGCAGACTGGAGCGTGTACTACCCTCAGATCGGCCAGG
GTCT