Description :
From Genome Similarity Track
Location :
contig_36:202041- 204051
Transcript NameFunction/comments
g9185.t1hypothetical protein

Sequence
2010 bases(100 bases per row)
TTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGATAAAACCTGTCGACACGACCGCGTCACTCCGGACGCTTCGAGACCC
TCTCGAATCCGATCGAATCAGGCCCTGCTGATTCGGTTCACATTTCCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTCGGGGTGATCCGAGACAGCC
GCATTCCGCGCTGTCTTTGGTGAAGGGCCGCATGCATCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGA
AGTGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGAC
GATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCATACGGGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCC
AATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAA
GAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCAGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTTTCACTGGGGGTAGCGATCTT
CATTGCAGCATGTCCGATGTCGACACGCTCGACCGCATCACCAGCAGGACTCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGTTAGACCGTGACGATACC
CAGTATCGCCACGACGGCTTCTCGCCGTGTGCACCTGTGCTGTGCACTCGCGAGCGTAGTGATCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGA
TCCACGGTGCTGCTGGGAACCAGCAGTCGTCGCACTCGAGAGGTTCATTGGTTCGGGACCTCCCGACGGCCTTACCACCGGTCGTGGCATCAGTCGCGGG
ACGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCGAGCGCAATTGCATCCTCGAGAGTTTGGATACTCTCGGAAGAAATAGGTC
TTCACAGGCCCATCTCTAAGGCCCTTCATGAACATGACGACCTTTGTCGCCTCATCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCCCTTT
GGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTTGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTC
CACCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGGTCCGTGAGTCGGCGTCCGTCCGCCCAACTCCTTGCTCGTCCGCCAAGACATGACATGGCGAAC
GCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTCCCCCCTCTCTTCCAACGTAGC
TACTTACGTGGAGTTTCAATGACTCCCCGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAG
AGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGCCTCCCACTCTGGTTCCGACAG
GTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGTGTTCGTAT
TCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCA
CGTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCGCAAGTTACTTAAACCTAGATAAAGGGACCGAACGATAGCTTTGGTG
CCAAATGAGA