Description :
From Genome Similarity Track
Location :
Scaffold_35:202017- 203099
Transcript NameFunction/comments
Phyca_LT1534535379Hypothetical protein

Sequence
1082 bases(100 bases per row)
aatggaaagaattgagcgatgcttgtcattgttttagtgctaaaacgaagttctagtcagttgaagatgctgcgtcagttgtactgacggtattagcgat
acgaacggcgttgtgtggtggagaagacggagactcccttcttgcctgctttctttttcccgcccttaccggagttccatgcagtgacaggaggactggt
ggatggatttccccaagcagaaggcgagccgaatgcaatcggatctctagattcactcggaccaactcctccaagagctgggaagtatccagagttctcc
gtcactcgagcaaacgaccgctcttcatccgttgaagacgatactgcatgcaactcagcttcgagctcgagactggacgaattgctgaggtggaattcct
ccagagactccgccagcgcttgctcgtaaggtgatggccacatcatcccctcctcttccagggaaaatgcatctgcatttcttttgaagatcggagatga
aggtgttggcgtgctctgctgtttcatcttgagcttccgctgcttcgtgcgcttcttgaggtcgtttcggaacgcgttaagtgtcgactgcgagagttga
gacgtcagatccagttcgcaaacgtaaaagtcgcagaagcgtggcaagtggcttaggaaacgataacgtttctgcgcttcctcgtccattaccacgtgct
caatgtccagaactcgaccgtggatctgttcaggtagcagctgatagcgatcaacaggaagcggctcagagccggcagaagatgaaccctcttgagtcca
cgcagcttccagttccttttggtgcgctagctcttgactgtcctcttcttgctcatgttgatgggtatcagagaactccttcagcagacatttcatgttc
aaagggtgaagaaccacgtatgtcccgtcagcaagctggtagaacgagtacaagtccccactgttgtcatctcgaggcttccccttcttacctgcaacat
tggctatgttgctgtggtttgcaccgtacgtgccgtgggtaaagtcgtcactcttggcaagccgtccggaagtgttccgcat