Description :
From Genome Similarity Track
Location :
Scaffold_164:20201- 23418
Sequence
3217 bases(100 bases per row)
CTGGAAGCACTTCCTACGTGACTTTAAGGGAGGCACAATCGAACAGGTATGCCTGATCACCAACGAGGTGGTTACCGAGACAACCAAAGAGCATATGACG
CGTCCTCGTTGCGCTGAACCAAAGTCAGCGCGTGAAGAACGATTTGAGTCGCAGTGATGGGACACTATCCGAGAGTCTGGGAATCATGTCTACGACATTT
CTCGTGATTATGCAGACGTGTTCCCGAATAAGATACCGGCTGAACTCCCTGCTGACCGTGGGGTTCGGCACGAGATTGATCTCGTGCCAGGTTCGAAGTA
TTGTGTGACACGACAGTGGCCGTTACCTCGAGATCAAGTCGAGGCTATTGACGCATACTTCGAAGGACGCCGTAAGGCGGGTCACGTGCATGAGAGTATC
TCACCACACTCGAGTCCAACCTTTTGCGTGAAGAAGGCTACGGGAGGCTGGCGGATAGTGCATGCATTTAACAAACTAAATGATGCCACTATTTCTGCGC
AAACGCCTATCTCCAGGAAGGACATGGTGTTAAACGCCATGTCAGGGAGCTTTATCTTTAGCGCCATCAATCTAACCTATTGCTTTTACCAGATTCTGAT
GAGAGAGAGCGACATACCAGTCACACCAGTTAGCACCTCGAGTGGCATGCTATGGGAATAGCTAGTAATGCCACAAGGGTTGAAGAATGCACCTGCCACT
GTTAATCGCATGGTGCCTCAGGTGCTGAGACCATTACAGAACTTTGCTCCAAGTTACTTCGACGATATATTCGTCCACAGTCGCGCTGAGGGCGACCTCA
GCGAGGTCCAGGTACACCCTTCAGCACTTGAAAAGAGTATTCCAAGTCATGCGAGAGAACAAGCTCTATGCGAATCTCAAGAAGTGTGTCTTCTGTGCAC
CGGAAATTCCGGTGATGGGTTGCTATGTGAGTAGATCAGGTGTTCGAGCTGATCCAGAGAAAGTTTTGTCCATCTGTTCTTGGACCACACCCAAGAACCC
CACGGAATTACGTCAGTGGCTTGGCTTGGCTAATTACTTGGATAAGTATACAAAGGACTACGCCGGTTCTATACAGCCTTTATCGTCACTTTTGATGAAA
GACGTCACGTGGTTGTGGCGTCCTGAACATCAAGCAGCCTTCGACGCAGTGAAGAAGAGCCTGGCGTCAGTGCCACTGCTGGTCCTACCGGACGACTCCA
AGCCATTTCACGTCGTATGCGATGCAAGTGATTTCGCGATTTGTTGTGCCCTCATGCAGTTTGATCATGAGGGCCGTGAACGATTCATGAGCTATAACTC
ACGACAAATGAAGCCAGCGGGAAAGAACTATCCAGTTCACGACAAGGAGTTGCTAGCGATGCGCTACGCACTCATCAAGTTCCGCGTTCACCTACTCGGT
GAACGCACGTTTGATTTGTACGCTGATCACGCATCGCTGCGCACAGCGATGAAGAGTCCGCACCTGTCCCAGCGAATGGCACGGTGGCTTTCGTTTTTCT
CCGAGTATAATTTCGTCGTGCATTACAAGCTGGGCAAGAACAACATTCTTGCCGATGCTTTGTCGGGACATCCCTATTATGATCCGCGGACGGCGTTGAG
TCGTCAGGCGACTGATAACGAAGAAGATGATGATCGTTGCACGATGTGTGTGTTGCTGAACTTAACTCGGGTCAGTCCCGAGCTGTGCTTATTCGACGAA
ATCGTCGCAGCTTACGCGAATGATCCAGACTACGCCGATATAATCGCTTATCTGCGCGCACCCAGTGACGTTTCACTGGGTGATCTTTCGAGAACCAAGC
GTGATCATATTCTGTGATATAGTTTGGACGGGGACCTACTTCTGTACAGCATCGATCAATTCGATGCTCCTCGTACGGTGATCGCCAACGACATGGATTT
GCGCGCTCGAATTATTCATGAGTACCATGATGCTCCAACTGGTAGTCATCTCGGTCGCGAAAAGACTTTCGCGGCTGTGTCTCGCGACTTCTTCTGGCCT
CACATGTACAAGTGGGTGCGCAACTCGATTCGTACGTGTAAAATCTGTCAAAGAGTGAAGCCATCTCCATCGTCGCAGGCTCCCCTGCGACCGTTGCAAT
AGCAACTGAGGCTTGGCGCTCAGTTTTCATGGATTTTATCTTCGGGCTCGCACCCGATAGTCAAGGCAGAACGGGTATTCTGGTATTCGTGGACAGATTT
AGCAAGATGACACATCGGGTTCCTGCCATGCTAAGGTCACCGCGGCAGAAACCGCGGTGTATTTCATCGAAGCTGTGTTTCGCAATCATGGATTTCCGGA
AAACATTGTTTCGAATCGCGATCCTCGATTCACATCCGCGTTCTGGACGTCACTGTTCGAGCTTCTCGGTACGAAACTACGTATGAAGACAGCGGCCCAT
TCGGAAACGGACGGGCAAACCGAGCGAGTAAACCGAGTACTCGAAGATGTCCTTCGAAGTTACGCTATGTCCTCCACGAGTTGGAGTGCGTTCCTACCAC
TTGCTGAGTTTGCGCTCAACAATGCTGTACACGCGTCAACAGGGTTGACGCCATTTTTGTGAAATCGGCTCGACATCCTCGAGTTCCTACCCTACTCGCC
GAGGGGTCGCCCCACGGCTCCTCGCGACTCCTCTCTGGGGGGGGTGAAAGTGATAAACAACGATCGAGTGCAGCCCAGGGTATTTTGAACGCGAATGTCG
TCACCCGATACAAGGCGAAGTCTACTATTGTGACTCCACGTGACGTGGCGTCCCCGTTAGCTCGCTGGACTGCGCAGACACGAATTGACCCGGCTTCAGC
TCAACCAGTGCCTTCTCCGAATGCCAATTACGTGCCGATTGAGTCGGTGCGACCAATTGATGACGCGGCTGTGTCGGAGTTCATAATCCAACGTCAAGCC
ATCACCCGATTTTTACGTGACGCAATTCAGGCTTCAGTGGACAAACAGAAAGAAAATGCGGACAAACATGGCAGGAAAAACATGAACAAGTTCGTTAAAG
TTGATCGTGTATTACTCTCTACAGAGGTTTTAAGAGATTCGGCGGTTACTAACTTAGGTGCGAGCAAACTCGCGCCACGCTTCATAGGACCATTCAAGGT
TCTCAAGGTGATTGGTGATGCCTACACGTTGGACATCCCCACGTCGCTGCGTCTTCACCCGACGTTCTACGTCGGGTGGCTTAAGCAGTATCGCCCGCGC
CCGGCTACGCTTCAAGG