Description :
From Genome Similarity Track
Location :
Scaffold_1273:202- 4322
Sequence
4120 bases(100 bases per row)
ACGGAGAGAAGAGACAGAAATCAGGTCCGACGTCAGATCCAACGTCCAGCCCCGATCCAACGACCACTGAAAATCCGCGGTACAAAGACTCAGAGGCAGA
TGACCAAGTCTGTTACCATGTGAGCGGAGATCTACACGCGGAAGACGTTGAAGCTGAGATGGCCGTATTGCCCGAAGTTACTCCGGCTACAGAGGAGGTG
ACAGTCGAAGACATCCAAGTGGGAGATCCAGATGTTAATACGGCGGAAGAGATTGACCGACTTCGGCGACGGATCTACACCTGCTGATTGGCAAAGGCAA
CGCGCTGCTTTTGCGGCGCGAGGCGTCGTGTGTGACATCGATGTCGGGGATGCTAAACCCATTGCCCAGCGTGTGCGGAAGGTGGCGCCGCAGTATCATG
AGAAGTTGTCGGATCTGATCATGGGATTGCTCGGTGCCAAGATCATTAAGGATTCAACTTCCCCGTGGGCATCCCCGATCGTGGTCATCATCAAGAAGAA
TGGAGTGGATATAAGGTTGTGTATTGATTACCGGCTGGTTAACAGTCTGACCAGACTGATGATCTACCCGATGCCCCTGATTAATGACCTACTGGAGGAT
CTGGACAAAGTGCTGTGGTATTGCTCGTTGGATATGGCCAGTGGATTCTCGGTGGTGACTATGACGGATCGGGCTCGTGCGATTTCCGCTTTCATCACCC
CGTTCGGATTGTACGAGTGGAACCGGATGCCCTTCGGATTGAAGAATGCGCCTCAGATATATCAACGGATGCTGGACAACGCGCTGTACGGGTTCACCCG
GATCCCACAGTTGGAAGGTGGATCGGGATCGGACGGCGGATCGAAGGTCACGTGTGGGATTGGATCGAAGTCACTGAATCTGGATCTGAAGGCAGGAGAG
CCTGAGGACCCTGGCAAACCGTCGGTACTTGGACGGCGATCCTACATTGATGACATCTTGGTGACCGCTGGATCCTGGGACCACTTGTGCGACCGGGTGG
ACGCTCTGCTGGACGCGTGTGATAAATGGAATCTTTCGATCAGTGTGGTGAAAAGCTTCTGGGGCAAGAGCAAGGTGGAGTTTCTAGGCCATCGAGTGTC
CCATGCTGGATTGGAGGCAAATCCTAAGGATCAATCAGCCCTGACGAATCTACCCTTCCCAGGGTCCCTCCGATCCATGCAGTCATTCCTCGGCAGCCTG
AACTATTACAGTCGGTTCCTGGAGGACTATGCGATCTACGCTGCAGTTCTCTATGAGCTACGAGAAGTGGACTTCGCCGCGATGAGTAAGCCGGACAACC
AAAGCGCATCCAACTCACCATGGGTTTGACGACCTCGGATCCAATAGATCGGCACTCGTCGGATCCATTAGGGCCGAGGACGGTGGATCTACAACTTCGA
TCTACAGAGACTTTCGACCTGGAGGCGAAGGATCCTGTTGGCGTGAGGACTTTGGATCCAGAGGCATGCGACCCAGGCAATGTGGATCTACGCTGGATCC
GAGCTCATCGGGCCTTCGCGACACTGAAGGAGAAGGAAGATGGCGAGGACTCCAATCCTCCGACACTTCAATATGGATCTGCTGCCAGTGGTGGTAGTGT
ATGCTAGCGAATGGGCCATTTCGGCCGCTCTGATGAAGGAGTATGACGGGATCCAGTACCCAGTCACCTTTACCAGCCGCACTCTGAAATCGAACGAGCT
CAATTACGACGTCGTCGAAAAGGAGGTGCTAGCCCTGCTGCGGATTCTGGATCTGAGCTACAATATGTTGGTGGGTCGCCAGATCCGGGTCCTGACTAGG
CACTCGACTCTGGCCTGGCTGTTTCGATCCACTGGTCTGCAAGGACGGCTCGGACAGTGGGCCGCACTCCTTTCGCCATATACTCTTGAGATTATGAAGT
GCGCAAAGGGCGAGGACGAGATCCTAGGAACGCTGGCAGCCAGTATCACACCCCGATCCAAGGTGGATCGGGCATTGATCGACATCGCACCTAAGAAGGA
GCCGCGACGCAATGTCCAAGCTCCGATCCCGACAGTACAACCTGGTGAAGAACTCTATGTGGTCAGCTTTGATGGATCAGCGCGTGTCAAGCGAGGAGGA
GGCGCCTACAGTGCGAACCTTTGGAAACTGCCAGAGTGGAACGTGGTGAAGGCTAGATCCGGGTATGCCGAAGGTCTCTCCGTCAATGAAGCAGAGTATC
ACGGACTTCTGCTATGCTTGGATCTACTCGAAGGCGAGGCACAGTGACGACTTGTGATCTGTGGTGACTTCAATCTGGTGGTCCGCCAGGTCCGAGGTGA
GATCGACTGCATGGCACCTGGATTGACGCTGTTGAGGCAGAAGGCGCTGGATCGACTACGTGTCTGGCCCAACCACGAGCTGGTGCATGTCAAGCGCGAC
TGGAACGGTAGTGCCGACACTCTCGCTAGCGCGGCACTCCAACGTCAAGCCGGAATCATGGTGGAGGGTGAAGCGGACATGCAGGATCTAGTCACCTTGA
ACCGCCTGGATGAGATCCTGGTGGTGAAGACCGAAGAGGATGCGTCGCTCGGGTGTCGCCCGTAACAACCCGAGCTGGTGCAAGATCCCGATCCAACTCC
CGACCTACATCCAATTCACAGGTCCTACAGGAAGAAGTGGTGAGAGACCTCCGGATCGCTAGGATCCGCCAAGCGCAGGACGAGGAGGCGTGGGTCTCCG
GCTTGAAGAAGTATCTGGCGGGCGACATTCAAGGTCTGACGCAGGAGGAAGCCCGATCCTACGGTACTATTGCGATGGATTACGAAATGGATCGGAACGA
CCTGCTCTTCTACTGCCCTCCGACGAAGAAGGTGGAGGCGGATCGCGATGGATTGATGAGGTTGGTGCTTCCAGAGACGCTGCAGCGAGATGTCCTTCAT
CACTACCATGTCAGTCTGGAAGGAGGCCACGAAGGGATCGGCCGTACCTACCAGCGGATCCGAGATCACTTCCACTGGAGAGGCTTGTATCGGAGTGTCC
AGCAATATGTCGGAGAGTGTGTGGATTGCGAAACCGGCAAGGGGCGGCCCACGATCCAAGGCGAGTCGCCTGGCAACATCCAAGCCACATACCCGTTCCA
GATGATAGCGATGGATCACATACCGTCGCTGCCCAGATCCAACAAAGGTAATACCGTCTGTTGATTTGGGTGGATCTGTTTACCGGATACGTGATTGCGA
AAGCCAGTGACTCTCGAACCGCGCAGACTATTGCGGAATCCTACGAGGAGTGTGTCTTCAGGAGATTTGGTGCCAGTGAGGTGATCCGACACGACCGTGA
GCCGGGGTTCATGGCTGACTTCTTTCGATCCTTCAACCGGATCCTAGGTCAGCGACAACGCGCAACAATGGCGTATCGGCCGCAGGCGAACGGAACAGCA
GAACGCATGGTACAGACCGCCCCCGGGCTCTCAAAATGCATGTGCAGGATCTGGATCAACGCGATTGGGACGATTACGCGGAGCGACTCACCTTCGCACT
CAACACCGCACAGGATCGGATTCGCGGAGAAACACCTTCTACTTAGTGCATGGATGGGATCCTAGATCCACCCTCGAAGCGACGATCCCGGTGGGCAGCA
CTCGCCGTCAGGATCGAGATCCGAGGAGATGGCGGTACCAGATCCAGCGCTACTACCAACAGGCGCGAGCAGAGGTCAGCACACGATTGCAGGAGGCGAT
TGCGGATCGAGCGGATCGGCATAACGAGGAGATCCATCCACATCAGATTGAGACTGGATCCCGCGTCTGGCTATTCTTGGATCGGGTCAAGGAAGGATAT
GCTCGTAAGTTGGCGCACCTGTGGCACGGGCCATTCCGTGTTGCGGAGAAGATCGGTGAATATGCGGTGCGGATCGAGACTCCTGGAACCGAATACAGGC
TGTTCCCCGTGGTACACGTGTCCAAGCTGAAGTTGGTTCGAAGTTTTCCGGATCGTCCTCGGATCCAGCTAACTGAAGGCACTACAGATCGGTACGACTT
TGATGAGGCGCTGTTGCCCGAGGACAGTTGGATCCAGGATCTGGAGGAAGATGAATACGAAGTGGACCAGATTACGGACATGAGAACAGGGAGACGGACT
CGTTACGGACGGATCCATCG