Description :
From Genome Similarity Track
Location :
Scaffold_2146:202- 3170
Sequence
2968 bases(100 bases per row)
AAGGACAAATCGGCTAACGAAGACAGGTCCTTAGGATTCGCCTCCACTCCCTCCTTGGAAACTCGATGGCCTAAGTAATCCGGGATGTCACTCTTTCGCA
CAGCTGATCCCACGATTTCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGCTCCAGGATCCCCTGGCTCTCCTGCTTCG
AATGGATCCACTTCCGTATGATCTTCCTTGGATCCACCCTTTTCGGGTTCCGGTATTCGAGTGAATCCATAGAGGGTGCTATCGATTAGACGTTGGTAGA
TCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAGCAGTCCAAACGGTGTGATGAATGCGGATATCGCGCGAGCTCGATCCGTCATAGT
AACTACCCAAAAACCGCTGGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGATTAGAGGCATCGGATACACCATC
AATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATACCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACG
TTGAGAAACTGATGATCTTGGCTTGCAGCAGGCACTTAATCAGATCCGATAGGTTTTCTCGGAACTGAGGCGCCATCTTCCGCACCCTCTGAGCGATCGG
TTTCGCGTCGCCGACATCGATTGCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTC
TGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCA
CCGCCATGCCTTCTCCCAGGTCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAAACTTGCTCATCTTCCGTCTTCATAGGATCCACAATTGGATCCAA
ACACCGCGGCCCTCTTTCGCCTGGCAGTCCTTCTGTCTTCGGGGAATCAGGTACCCTGGTATCAGGGAAACCAACAGTTGGATCTAGTAGGTCCTCTAAC
GAGTTTAAGCCCGACGGTTCTGGTTTGACTAGTGTTGCCACTCTCGATAAGGATCCAGGCACTTTATCCCATGGAAAGCTTGGATCCACTTGTGGATCAG
CGGGATCCGGCTGTTCGGCTTTAACCCTCTGCAATCCTTCATCCACCGACCCCGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCGTGGATCC
AACCTCCCTTGCTTGGATCTTAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCC
GGGAGCTCCACCTCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACACCAAATTCTGCCATTCTTTGTAACGGCGGGATCCCACTGACACATATCCAG
GTCGCCTAGGGATACCGTCCTTCGCTAACCATCGCCCGATCTCCTCATAATGGTCCCGTAATAGTCTCATATCGCTGACGTTCGTGACCTGGAGGTATTG
TGATCGACCTGGCCCCTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTAACCGATCTGGCAGCTCC
CAGGTTTCCCCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCT
CGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCC
AACCCAAATGTCAAACCAATACGCCAAACAACCTGCCAGCGTGATCTTGATCCGTGTTCTCCCGTTCGTACGGTACACACCTTCACCAATCCCAACACAA
TCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTT
TTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGAGCATGGTACTTCCAGTATCCACGGGCTCCCCGGTTAGCAGATCCATG
GATCCTGCATCCTCAGATCCATGGGATCCAGTGACCTGACAAACTTTAAGGGGATCCGCCGTGACCTCACCCTTGCTAGGCTCAAACCATCGACCATGTT
GACGCGTCTCCCAGTAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGAAAACTCATCCACTTGGCGCAAACTAGAGAT
CTTGACAGCTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGACGTTTTGTTCACAAATGCATAAATG
CAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCCGTGTTTGGC
TGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGA
TCCCCGGGATGACCTTTCTTGCCATACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTT
GTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCCGTCTTTGCCGTTCGATC
GTTGGACGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCAAACCGTCGGATCCTGATT