Description :
From Genome Similarity Track
Location :
Scaffold_461:202- 20903
Transcript NameFunction/comments
Phymu_g10098mediator of RNA polymerase II transcription subunit, putative
Phymu_g10099conserved hypothetical protein
Phymu_g10100methylosome protein 50, putative
Phymu_g10101dual specificity tyrosine-phosphorylation-regulated kinase, putative
Phymu_g10102hypothetical protein
Phymu_g10103hypothetical protein PHYSODRAFT_354940
Phymu_g10104hypothetical protein
Phymu_g10105hypothetical protein PHYSODRAFT_511675
Phymu_g101061-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase, putative
Phymu_g10107hypothetical protein
Phymu_g10108conserved hypothetical protein
Phymu_g10109conserved hypothetical protein

Sequence
20701 bases(100 bases per row)
TGAAagatggaggtggcggcgcACACGGACGACTACAACGCGTCGTTCCGCGACACGGTGTGGCTGCAGTCGTTCCCGCTGAACGCGCAGACGGTGTTGC
ACTACTTCGCGCTGTCCCCGTTCTACGACCGGTCGTGCAACAATGAGCGCCTGAAGATGCAGCGTCTGGGTCTTGACCAGCTCAAAAATCTGCGCGGGGT
CgagtacgagctgctccCCAACGCGGCCAAACAGATGCcacagcagctcttcattATCCGCAAGCAGCGGCGCAGTGGTCGGACGCAAGTGGAGCCACTG
GCCATCTACTACGTGTTGGACGGAACTGTTTACCAGGCTCCCAACATCCACGCTATGCTCACCTCTCGCCTCGTATGGACGCAGTTTCAAGCAGAACAGC
GCTAGAGTTTTTATACTGATCATAACGTTGTGTATTCATGGCAGAAAAAATGCAGCTACAGGGTGAACAAGGCCTTCCACGGGCTGGCGGCGGGTGTGCG
CTTCAGCCCCACGGAGGGCTACGCGTGGGACTTCAGctccaaggacaagaaggagccAGTCATCCCCTCCGAACGTGAGTCGCTGGAGATTTGTTTTGTC
TCTGCAATGCACTGTAGCCGATGCTaattcctgctgcttgtagagctgcagctgaagctcaagcagaagtacgagaagatggagaagcagcgcgaaaACT
CGGCGCGGGTGGATTCCATTTTGATccagctcatgaagaagcacgCACCGGAGATTGcagagaagctggagaacaaCAATACCGTGGCAGCAGCTGGGCC
AGAGGACTTAAAGCGCGAGAGCGATCCTACCGTTACCGAGGCTACCAAGAGACAGAAAGTTGCTTGAGTATTCCTTCACTAACGCAACGCAACGCTTGTG
TTCCTTATCTcaacttgttgttgttatAAAAGCAAGATACATGCAGGTACGATATCAAGCTGCGTTTCATAGCTGTGTGTGCGCAATGCAGCGAAAGCCC
GTCGactacaacagcaagacTACTGGTCTTTCTTGTTGTCTGGCTGGCCGTACTTGCTGCGGACCTCGTCCATCTTCGCGCCTCCGTGGTGCTTGCCGta
gtcgatcttctcctcgagacTGtcggcagctccttccatCTGTGACTTGAGCTTCTCACTGGGCGGCACCTCACGCGCCAGCATCATACGTGGCTTCTTC
ATTTTGTTTACACTGgccttccacttcttcgGGTAGCGGCGACGGAACATGATCAGCAAGAAAATTGCCAACAACGGGATGCCGAAGAACGCGACGTGGC
GAGCGCAGATGCGATCCGTGGGCAGTGGCAGGCAGTACCCACGTTCACCGACGTTCTTGGCCGCCTCGGCGCTCTGGTACCAAGTGTCTTTCGCTTTCCC
ACCGGCACTTTGCATCGTCTGAGCGACGCGAGCCTTGATACTCTCAACGCGCTCTCCAAGGTCGTTGATCTCAGcgctgagcttctcgctcgTTGCCTTC
ACGGAGTCCATAACGGTGTCGCTGATTGGGTCCGTCGGCACTGGGGCGGAGCTCGGCAGCCCACTGGACTCGCGCACCGAGGCGGCCGCATCGCGCATCA
CCTCGTTCATGTGCTCCATCTTGCCTCGAGCGTACTCACCGAGATTGCGAGCGTCTTCCTGAAGTTGCTCCAGCGTGCGGCGACTGCGATCGCCGAGGTC
GTTCTTGCGGCGAATCTGCTCCGCCTCGGACAGCATATTGTCCACAGCTTCGGACGCTGCTTCCTTGGCTCCACGTTCTTTGGGCATGTGGCTCTTGGCC
ATACTGGTAGGCATTCGCACCATGTCGGTGTAGTTTCTTGTGGTAGTAGGCGTTCACTTGACTGCTGGGCGGCGTGTTGCAAAGTGAGAGAGCTCTGCAA
AAGCGAAATTCCTTGGGACGAGGACAATGGAAGAAAAAGCTCCAACTTGTCGCGTTTAAAAAGCACCTAGCAAACACGATAGTAAAGCAGCATCTACGCA
GCAGGTCCCAGAAGGAGAGAAGGGAGAAGAAAACTCCAGCCTTTTGGGTTTAACGGGTGCAAGGAACTTGTTGCctttcacttcaacatcgtgTGTGCCA
CATCAAACATGTTTGCGACAATTAATTTTCGATCTGAAGTAACGCTTGGACAATTGGGAACTTCCCGAGCCATTAATTGATCCAGAATGGCACCGCAGCA
CCCTGCCTTCACTTCGGCCGCGCAGGTGGACGCCTTGGCGGCCTGTTTACTGCCGAATCTGCTGTTCtcagacgacgatgacaatGTAGAAGAACCGGAA
CTtccgctgctggctgtggcaCAGTCGCAGCTCGAGGGCAACGTGTGGAACGGAGGCGTGGCATTGCTGGATGCGGCCACGAGCGAGCGACtgtgcgagc
tgcagctggaaaCAGGCGTCGGATCTCTGGCCTGGTGTGGCCCGGACGGGGATATGTTGGCGCTGGGCTgcgacgatggcgacgtGCGTCTGGCCAAATT
GTCGACGGACGTCGCTTTCGCCTTTGTGCCCATTGGCACGAGCAACGAAGAGGACGCAGTGGGTGGATGGGGacacgacgatgtcgtcACAGGCGTCAGC
GTCTCGAGTATTGAGAAGACGCAATTGGCCACAAGTAGTTGGGACCTCACGTACGTTTAGTGAGCTGTTGGGGATTGTAATGTTACGTTAACGGAATGTT
GTGCAGAGTAAAGCTCTGGGATGTCAACGCAATGGACAAAACAGTCGCTACATTTGACGGTAAGCGGGCGGAGTGAGGCTGGAGATCGGTGTCTTGTTGC
TaattgttgctgctttgcTGTTTACAGGCCACACGGACTTAATTTGGGGCGTGGCGATGAATCCGACCCACGCGCATATATTGTGCTCGGCATCACAGGA
CACCACGGTACAGGTATGGGatgctcgtcgtcctcaaGGCGCAGCGTTGGTAGTGTCAACGCTTCTGCCTGCTTTGTCGGTGGATTGGCACCCGAAGCAA
CCGACTGTGTTCTCGGTGGGACTGGACGACGGCATGGTGTGCACCTTTGACGTACGCTCGCCACACACTCCTCTAGCGAGACGTGAGACGCACAGAGCTG
CGGTTCATGCGGTCAAGTACTCGCCGTATCACGAGGACTTGCTGGCGACGGGAGGTGATGATGGCAAGACGTTCGTGACTACCGACAGTTTTTCATCCGA
CCGAACTGCAGGCAGCGGCGTTCGTGAAATGCTGGTCGGAGAAGAGAAGACGGTGCCGCACCGTGACTACGTTCGTGCGCTTGACTGGTTCCAATTGGCA
GCCACGTCGTCTCCTGGTGACAAGAAGGTGGATACGGTGCTCGCAACAGGCTCCTGGGACAAGACTGTCCACAAGTGGAACGTGGACGACTACACTGCTT
CTTCGATGGATACAACATCTGCTGCAAGCCTGACTGCTCCTCCAGGAGTGCCAATTCCAGTCGCGTAGCAAGTTCTAACATGGTCAAGTGTCAGATGCTT
CGCTATATTCATATTTGCACGGGTTACTTCACTTACTTAGAGCTCATATTCTACAGGATTGAAGGCGTGATGGTGGAGTATCCAAGGTTCCCGAAGCGCT
TCATTGGGACTGAGGCGTTGGCTTGGATCCCACACAAAGCACTTTGCCAAAAAGGCCAAAAATTCAGGATCATCGGACTTCACTGCGCCGATGAGGCTAT
GAGAGCCCGGAGTGCGTCGGCGGCCACGCGAATTAACGAACGGCTTCGGGACGTAGTCCATCGCTTGAATATCTGCAGGGTTGGCCACTTCATCGAAGAA
GTTCAGGCGTCGTTTACATTTGCGAACGAATTCGATTGGCGGGGCCCCGAGCACCTCCATGATGCAAGCAAACTGCTCCCGTTCGTTCTCACCGGCAAAA
ATGGGATGCCCCGTGTGCAGTTCGACCAGGATACAAGCAAAACTCCACATGTCGATCGCACCCGAGTAGGTATGACCAAGCAGCACTTCAGGACTGCGGT
AGAAGCGACTCTGGATGTAGGTGAACATGGGAGCGCCTTCGAGACAACTGCTGCCAAAGTCGATCAAAGATACATTCTCCACGATGCCCGTGGTGCGCGC
GTCTCCTTCCAAAGCCGAtgcatccagcagcacattcTCCGGCTTGAGATCGCAGTGAAcgacctgttgctgctgcagaaaCGTCAGGGACTGAGCTAAC
TGCTTGCCAATTGTGCGGACGCTGCTCATAGGCAAGCCATGGAAGTACCGCAGCTTGAGGAAGTCGTACAAGTTTGTGCCGAGGACTTCAAAGGCGATGC
ACACGTGGTCTCGGAACTGGAAGTATTCCTCCATGCGCACAACGTGCGGATTCTCATCACACGTTGCGGCTGCACGCTGGAGTTGAGTCAAGAGCTGCAC
TTCCACGAGTGCTTGATCGCGGTACTTCCTCCGGTTGCGAATGATCTTGACAGCAACCTGTTTGCGAGTGCGGTGGTCCATGCAGCAGACAACCTGGCCG
AACGAACCTTGACCTAGTGCGCTCAGCACTTCATACCGGAAAGCCAAGTGGTCTCCCATCAAGACCAAGTAATCTCCGTGCTCCTCATCGTAGCCGTCGT
TGTACAGCTGCGTAGGAACCCCAACGGGTTCCTCAACAAcggcggctgctgcttcatctccgtgAATAGGCAAGTCATTCTGGATCTTACCATTGCGGCG
CTTGCGTTTGACCGCCAAAGTTGATACGAAGCGGATCTCGTCGTACTGCAAGATCTCCACACGTTCAAGCGCCGTgagctctgctgctttctcTGTATCC
AGCAAGAACTGCTTGCCGGTAAGCGGGCAGGGCCTCTGCCTGAGCTGTGGAGCTGATTCGAACCTGTTTGGTCGAGGTTCATGCTCGTGTCTCTTCCTTC
GCTCggcctctgcttcttcaacgtcgcCGCTAAGGCGAAGTCTCCTCTGTGGGTGCTGTTTGtgctcgtccttggtcttgtccttgtgctgcagatgctg
taGTCTTCGTCGGCCGCTCTTATCGCCCACAGGACGATGTGGCTGCCAGAACTTGCGCTCTTCAGCCGGTGGCGTCGCCACGACGCCTGTAGGTTgcgct
gagctgctgcccGTGGCCAGCAGTGAACTGGTTGTGCGGCGGATCAAGTCCAGCGGGCGCCGGTTGAAGAAGATATGCGCGATCGAAGAcggcttcttgc
tgggcGGCGCAGCGGGTCGGCTGTCTGTGGGCTCCTCGAACTTCTGCGGGGCGGCagtcgagctggagctgggtGGCGCCGGTGTAAGCGCGGGTAGAAG
ACGCTGCGCGCGCCGAGGCAGCCGCGAGGAGCGGGTCGTAGCGCCTGGCGGCTCCATACTGTAGCTGCTAAACTGGGACGGATTCTGTCTGTTGCCGTCG
CTAAAACGGGAGTGCTGGCATTATTCTTTTAGCGACACGCTTCTTCAACGGTGGGGAGTCTCACGACGCATACTGGAAGTGAATGTCCAGAGCCACAGAT
CTGCACAGATGCCTGCTCCTGGAGTTGTCCCAGGCCATGAATATTCGGCATCCAGTTGcctgctggcgctggcgagCGTGAACGACGACTTGGTTTCACT
ATGCTTTTGACCGAACACCCTCGCAGCTGGCTTCAACATTTCTTTTGGCGAAATGCTGGCGCGAAATCAAGAACCGGTCGGTCACCTCAATTCTGCCGGT
GAACCCATCACTGGGCGTTACGGAGAGCTCTTGGCAGTATACGAATGACCGCCGCGCTCTGGTCGCAGAGCAGGCAGACCAGCGTTTGTTGCGACGCCTG
TTTGCCGCAGCCGCAACGCGGGCTTTAGCGTTGACGTCTTATTCGCGAGCGTCGAGGTCTTCGGGATCGCGATCGATCGATCTTATCCCGACGATGCCAT
TGCATTGCAGCCTTGCGCCGGGCGCCGGCGgtttcagcagcagtctgGCTTCTAGGCAGGGTGACAATGCCACTGGCATACAGTCCCCATGCGAACAGTG
TAGTGTATCGGAACTGTACGCGACGCGAGCAGCGGAGGCTATGGGGAAGCTGCATGCTTGTTCATGCCACTGGCAGCGAAGGAGGGAAGGACTGCGAGGG
AAGGAAGGAAGGTGCCTTTTGCTGAGTGATCCTCCTCAAGACTGCTGGATTCACCTGTTGCCGCATTTCTGATTCCCAGTCTCTATGCAAGTTGCCGTTC
GCCTAGCGAAATGGTTTAGCAAAATCGGCAACTCAATTTTTCAGCACCACCGGTCTCGAAAGATCGATGTCGAAAGTTAAGGCGTAAGAATCCATTTCTC
GGAGCGAATGTCCATGCGAAGGAGAACAATtttgccttcttcatcgcaGCCGCCGGCAAATTAGTCGTCACCTCGGCTTcgtcgacgacagcagtgacgt
GAGAGGATAGATCGCGGCGCTTGACCGTTGCActtgaagcttcagcaggcTAGCGGCCCCGGACGATGCGTGGTCCACATCGAGCACAAAAAACAATCTT
GACTCGTTTTTTTGCACTTTCACAATAGCGGGAATGGCGAATGCGGCGAGAGACTGCCGCGGCGGTCGAGCGAGTTGCGGTCGGCGgcgccgccttcatc
ttgatgATCGGAGCCGCTGGCCGATCAGGTCGCTCGGCCCGATTTCAAATCGGCGATTTGCCGGGGGCCGCGGCGGAAACTTGCTTGGGCCGAGCCTACG
CTCGCACGCCATCGCGCAGTGTCCGTCCTTGTGATATGGCCTGCTCTATCGCCGGGCGTGACTCAGTGGGCCGCAGCTGCCGAGTGGCCAGCTCCGCCGC
CATTTGGACCGAAGTCAAGTCGGTTTGCCGCGGCGTCACGGGGCACTCGCCCGGGATAAAGACGCGCGATAGGGGCAAGCCGCGGCGGCTCTGTCCACGC
CCAAGTGGTCCCTCCACTGTCGCCGGCAAAGCCGCCGTGCGGCCGGCCGGGGCGGCGGAGGACTCGAAGCCAAGCGAGCCTGCATTGCCGAGGCCAACCT
GAGTGCGAGTGCCGTCGGAAGCGCGCGCGAACGTGCGTGGAGCGGGGCGTTTACGCTTCAACCGCGGCCTGATATTCCAACTCAGGCAGGCAGTGCCCGC
CGTGGCAAGGCAGCAAGCTACGCGTGTAACTTGCTGCCGCCATGACCCATTGCAGTAGGCTGCGAGGAGCTCGCGCGAGATGACCCTATATTGCCACTGG
CGCTAAGCTTCGACGGCGCCGTCCTCGCACCTTAGCGCCTAGATCGCGCCTGAACCCACGCCTGTTTTGGCAATCGCACGCCATAACTCGCTAAGATATC
GGCAGACGAGCACCGCGGCAGCTGGGCGTTGATCGACCGTCGTCAGCGTCCCACGCAGGAATGGCAGCAATGCCAAGCCTGGCAGGCAACATGGCTCCGC
TTTGGTCTCGGGCTTGCCTTGACGGTCAAGTTGCTGGCGAGGCGTTGAACTTCGGAAAAGAGGGTTTCAATGAGGCCAGCCGCGGCGAGCTCATACCCCC
ACCTCTGGTGAGGAGAAGTGGCTGCTGCCGGGCAACCGCTCGAAGCATAGTGACCACCACGGCAACGGAAGCCAAGGTGCCCACTGCGCAGCAAAGGCCG
GAAGATAAGGCAGAGAGCCGAGTGCAGTTggcgacgagatcgaagaaAAGCCTGTGACGGAGCGCGCCCTGCTCTGCGAGCACTGTTACTGTAACTCGAT
CGTTTCGGCCAGCAGCCCCAAAACTCCAGCCGCCTCCGCCAGGACGTGCACACGGGTAGCGCCATCAAGCAAGCGTGATGCCGGTTTGGGCGTTTCTTAG
CGGAAAAAGGCGCAGGAGTGCCCTTTTTTCAGCTTATCGTGACATTTCGACTTCAAAATTCACCCTAGCAGTAGCATTACCAGCGCTGACAGCATGCAGC
GTGGCAGCCGCGCGGTCGGGTGACTATTCGCTGCTGTTACTCACCGCACTCGCTGCTCCTTGGTCATCTCGAACGGACACTTAGGCGAAATATTGGCCTG
GAATCCAGGCTGGATATTGAGGCGAAGGCGGGTATGGAAAGCATGGTTTGAAAATCTGAGCGGTACTCGTGCCGATTTCTGCAAAAAGAAACAATTATGC
TTGAGTATGAATCGAAATTCAGCCAATCAGCCAATTGGCGTGCCTGCCCATCCTTCTTGTTGTGATATTTGCTATTCGACTGACGCATCCCGCCCGAATT
TGGAAGGGAACAAATTGGCGTGGCACACCCCACGACACCAGCCTCCGCGCGCACCAGCCCAGCGCCGGGCCAGTACCATTCGCCATCTTGCTGGCCACGA
CGCACACAGACACAGAGACTTCTGGTAGCCCCGGTCCGTTCCGCTCGGGCTCGCCGCTGCTAGTCCAGACAGGGAAGCATCAATCCACGCACATCCTCCA
GACCCCGTGCGGCAGTGCAGTCAGAGCACAGGGAGTGACAGGGAGAGCTAGGAGAGAGAGCTAAGAGCTAGAAGAGAGCAGGCATGGAGATTGCCAAGAA
CGTACGCGACTTTCTGGTCGGCATGAAGGAGGCACTGTCCCCCGAGGAAGACCAGCTGCTGTCGAGCCTGCAAACGCTGCACGAAGAGTATCTCAACATC
ATGGAGAACTTCTTGGCGGAGTTGAACTCCAGCGCGCTGACCGTGAGCCCCGAGGCGCGCATGGTTGCGCACAACCTTCGCCTCAAGATCTACCAGGATT
GGCGCGCCAAGCTGATGGAGCGCGTGTTTGACAACTCGATAGAGAACGTGTCGGCCGAAGACGCGGAGTCCCACGAGGATGGTTGCGATTGCTGTTTCtg
cgagctgaagcagcggTTGCGAATGTACGAGAGCGTGATGGCAGACTACTTCGCAGCAAGTACAAAGATCAAGAGTCCGgagaacgacagcagcgaggat
AGCGTCTTTAAGATGCCGGAGTTCCTGACCACGTAGGCGCTGCGCGGTCGGGCACGCAAAGCTAGTTAGGGATTTCTCGGCAGCGAGTGCGCCGGGAACG
CCCGCGGATCTCGTGTGGAACGAAGAGAAGGACTGCATCGCGAGATGGGACCGCCCTCGCGCCTCGGGGAGGCTACCGAGCAGTACAATACGTGGAActa
ctacaacaacaacaagaagaagaggcgcTCGCGCTGCGCTGCGATCGTGGAAGTCGCGGCAACGTGGCGCGAGCGAGTGGGTGTGTGTGGAACAATAGAG
TGCTCCGACTgcgtcttcgccgtcacCGGAAGCGCGTGCATTACAGTCGGTAGTGGTATTATGACCCCCCCGCCTCGATGCGCAGGTTTATAAGCAAGTT
TATAAGTACAAAGGGCTCGTTTGAATCATTCGCTAGTAGCGTAGTGGCAGGGGGGATTGATGCCAGGCATTGCCAGCAGATTCGCGCCATTCCCCGTTGC
CGCACCCCACGCTCCGCTGTACACGCGCCAGCACAGGAGGAAACGAGCCAAGCAGAAGAGTACGAGCGCGTGCGCATAACTTGCCAAGAATGCAGAGAGC
TTCAGACAGTTCGTTCATTCTTGTCACTGCCAACACCGTTGTTACCGTGGTCTTGCCTCACGTTGGCGTCGCCGGCCCCTTTCAGGCCAAAAAGTATCCT
TTCTGCGGTACCGACCGCCCTGGCACGTGCGTGGCCGTCGGTGAGGCCAGCACGGCCGCGGCCGCGCTTGCCACATGGTCTGCCACGTTGCGAGCGGTGA
AACCGCGGAGCCGACGTGGCCATTTCGGCGTGCTGGTGTGGAAGGACCATGGCGGCGGccacatgaagaagctccacgTGCATGCGCGAGCGGCGGCGGA
TACTGGAGCCGTCAATGCATTGCGCGCGGCTGGCTCAGGCGGAGCATCCGGTACCTGCACAGTCTTTGGCTTGGACGGGCTGGCGTTGCACATACGCCAG
CTTTAGAGcctgctcttgctgcaagCGGCAGATGGCAAGTGACCTCAATCTGCGCAAAGAAGTAGCGAGAAATTGTTCGATTCGAAGCACAAAAATTAGG
CTAACTGAAACCTTGCAGAAATAGTATCACTATATGCGTTATAGCAAGTAAATCAGACTGCCAGACTGTTTAAGCAGAAATTATGTTGCGCACTCCCATT
CTTTTATACCGATATATCAGGATTCGAGAGCATTTGCTTTGAAAGAGACAACACCGTCATTGAATTTCCAAGTGAGAAAATGATGCGAAAAATCTGGGTT
TTCTTGATACTTTGCCGACCAGCGGAAGACCGCGGTGCTTGTCTTGTTGCAAACAAGTTGTTGGCGAGTGCTGGCGCGTTTCGCAAGTCGTTTCACGAAG
GTTAAAACACTTCGAACATGAATAAAGTTTGGCGATTTTCCGGAAAAGTTGATTTTGTGTACATACTTTGGGCCCGACGCTGCTTGGACCTCAAAGTTTG
AGGCCATTCGTCCACCAAGAAACCTCACGTTGCGCTCGTGAGGGTTCTTGGTGCGCGGTGTCCTCCAGTTGTTGCTCGTCCCCTCTTTGCCTcaccaagt
tgctgcagtcaaGGCGACGCAGACTGCACGGCGTGCAGCGCAGCGGCAGGCCTGCCTGCCTTCCCGACCCCAAGTTCCTCCAAGTTGGAGGCCAACCTCA
CCCCGGTCGCCGGGTCGGTGACTGCAAGTGACTCTTTCCTGAGTAGCTCGGTTGAGTCAAGCACTCGCTAAAGGAAGACGGAGTCAGCAACCACCGGCTG
GGCTCGGGCCTGTCCAccctacatgtactgcgCGGATAATGCGTTGATGCAAAGCAGAGGACGCCGCTCGCACGATCCTCCGTATCGCTATCATGGCGCT
CGGACTTCGGCCCGGCGGGCTTTGCAGGCTGCAACGCTGTattctgctggacgagtgctggtgcagtgcaCGAGGATTGAAAGCCGGACGAGCGTCTTGC
AAGTTGCACGTTGCAACGACTTTTCCCTAAAGGCTATCGTAACGGCGGGTACTATGTAGCGCTACTAATTCCTTGAGGAGTGCCCAATACGTACTCGGCA
ATGCCATATTGTGCAGACATCGAATCTGTGCATCGAGTCTACAGCCAGCAGAGCAACACCGGATAACAGTTCCTACCTGTACCGTAACCCACCGTCATTT
TCGTAGTCGCGACTTGGAAGGCAAAATTGATAGGATTAGCATGCCAGCAAAATATGACGATAATCGGTAAACGGTCTCGTTTGCGCGGCGGCGACGCCAT
CACGGTCGCAGTTCAGTGTTGGCTGCAGCGAGCGTTATGAGCTAGAACTTCGCCACAATCTAACGGCAGCCCTCGTCCAGCCAAGCCCGAGAAAGTGTCG
GCGTGGTGTGCCGGCGCTTCTGCTCGAATGGCTTCGCTGGATAAAACGTTGCCGACGAAGCAATTCGACGACAAGCCGGAAGTGACTTCCAGAAGTCGGC
AGTATGCTATAGTGTGCTTAGTCACTGAAGCGTGCTGGCGAATGCAAGCATCATCTGCAGTGCAGATGGTGCTTGACTTCTCCTGCCGATGGCAGGCAAC
CCGACGAGGAACACCACGCGAGGATTCTGCGGTTGTCGCCACGGTACAGTTGCGCAGGACAATGACATTGCTAGTagcaatttgctgcagcagtgctaCG
GGAACATTTAGCGCAGTGTGATGCAAGAAGGTTTTCGACAATATTTGCGAAACAGTCTACAGCATGAAATTTTGCTTGTTTTGCTCAAAATGTAAATTAC
CTTGCTGCTGTCAGCACTGAGAACCACTAGTACGGTGTGCGTCTGTTGACTTCCAGCTCGACACAGACGAGCGGATTGTGCACTGGTCGTCTTGTATGAG
GCGAGCCTCCAGCGATACCACCCCGTGCAACTCCGACAGCAGATTAGCCTTCTTGCGTAGCAGCTCCGTTTCCGACATCTAATTTTCACAAATAAACCGA
AAGTTGAGCTAAAACTTCACTGTAGCAAGGATAAGAGTACGCACCGTGCGCAGGCTCGAAGCGGTGAGAGTTTGCAGCGGAGGAGCGTTGCGGGACAAAC
GTGCACGGTCTTGTTTGCGGTACACGTTCTTGTAGAACTCGAGGTCTTGAGAGGACTCAATGATGCCTCTAGCGTTGGAAGTTGGTTGACGATCATCTGG
CAAAAACAATTAGAGTGTGCCTCTACAATTTTCAAAGCGGAAGCTCTGGAGACTGCATACCTACTTGTTCTGCCTTGACAGTCGGTgcacgaggagctgc
aagacgttCCATCGAGTCCTTGGTGAAATGCGCCTTGTGCGGAGCTACTCGACGTTCAATACGTTGTTTGGTAGCGACCGCGTCGGGTGCTTGTTTTGCT
ACCCCGCCCATGGCCTTCCACTCGGCAATTTTAGCattcagcagcagtgcgtGGTCCTCTTGGATATGGCGTAGGCGCTCACGATCGGCGCTTCGCTCAC
GGGCAAACTGCGATTCGAGCCGCTTAGCCTCTTGCTTGTTTGTGGCCTTGTGCAACTTTTGTTTCCGTTGCTCTTCTGCTTGCAGCGCGTCTTGCACCGC
TTGAATATAGTACGCGTTCTGCTTTGCGCGCAGTAGCTGCAGTGCTGTGGCTGCCTCTGTGCCCATACGTCAGCGCTTAATTAAATACAGGAATGGCAAA
CTCCATAAAGTGCGTACTCACCCAGTGCTAACTTTAGCCGTGTTGTAAATATGACAATACTTGGAGCACCAAAAGATCCCGAAATATTGCGTTAGTAAAT
GCGCGCTTACTAACGCAATATTCATGGTCTATTATCAAAGCCGGAGTTTTCAGCTCCGATGATAGCGATACGGAGGATCTTCCTGAGGAGAAATCCGTTC
GTCGATATTGCAGGATTGGGAGATTGCTGCTGATTCAGCACTGCTGAATGCCGCGCACCAAAACACCTCGAGATTTTGAGGATTCTCGGTGGACGTCATG
CCTCACAACGAAATGTTGCTCGAGCTCTCTAAACTGTCGGTCGGTTTCAAGCCAAAAGTTTCGGCAATTGTTCGTTGAAGTGCCTTCGAAACAGTCGAGA
TCTGGTCGGTGCGCTCGAAATTATCGTGCGGATTGCTCGCATTGGAGCCCTTCTTCGAAGTAAAATTGAGATTCCAAAACAATCTTGTTCTAGAGCCATC
TCTGTATGTCACTCTTCAGAACAGTGCCTGTCATATTGCGCATTTaacgctccagcagccatgCGCTTCCGGCCATGCATCGACATCCACGCTGGGGAGG
TGAAGCAGATCGTGGGATCCACTCTCACCGACGGTGAAGGCGCCGGACCCGTCACCAACTTCGTGGCTTCGCAGAGTGCGGGCGACTTCGCGCGGTACGT
TGCCAACAAGCTTTTAATCGTTCCGACAGTCCTGACGGCCATTCAAATGCTGTTTCCAATGTCTTTTTTTGCTGCAATAGgctgtacaagaaggacggGT
TGGTAGGCGGACATGTGATCATGCTGGGCCCGTCGGAAGCTAATACAAAAGCTGCACTGGAGGCCGTGCAGGCGTATCCTGGGGGTCTCCAAGTTGGCGG
TCAGCGCGAGCTGTAGAGATTTCTATTACTGAATAAGTTGAGAACTGATAGAGGTGATACCTGTGTTCTTGTTGTAACGACTAGGTGGTATTAACGCTGA
AAACTGCCAGttcttcgtggagaaggGTGCGAGCCACGTGATCGTCACGTCCTACGTGTTTCGCGACGGCGAGATCGACTTCGAcaggctggagaagctc
aagcagctcatcggCAAGGAGCACCTTGTGCTGGATCTCAGCTGTCGCAAGAAGGCTGAAGACAACAAGTTTTACGTCATGACGGACCGCTGGCAGAAGT
TCACTACGACTTCCATTGAGTGCGTTATACAgaatgctgcagttgaagtgccCGATTAAAACTGACAAAGCGTTTGGTGATGTTTATTAGCGAAGCGCTG
TTCCACCGTCTCGCTGAATATTGCGATGAGTTTTTAGTCCATGCCGTGGACGTTGAAGGCAAGCGATGCGGTATCCAGGTACAGGAGGCTTGCACTAGAa
tgtcgctgctgtctggcGCAGAGCTAATGTGATGCGTGTTAAATATTCCAGCAAGAGCTCGTAGAACTCCTGACTAAGTGGAGCCCCCTCCCCGTCACCT
ACGCTGGTGGTGCCAGCTCCCTAGTGCGTTTGCTTGACCTCTTCTTACAGGGCAGAAATGTGAAATACTCATGATATTTGCTGCTACCAGGACGATCTGG
ACTTTGTGGAGCGCATCGGTAACGGCAAGGTATCATCCAATTCCTATTGTCTGAGTGACCCAGTTGTTTTCTCATTCTAGTTGCACGTGTGCAGGTGGAT
CTCTCGATTGGCAGTGCGCTGGACATCTTTGGCGGCGACATTCGCTATGAGGACGTCGTTTCGTGGGACCAAAAGCGTGCAGATAACTAAGCCTTGCCAC
GCTTGGAAGCTGAGGTACTACAGTAGCTGGGAACTCATGTGTCAGCAGTCAACTGCGTGCAAGGAAGAGCAATCTGGATAGCTTCGTTGTGTTCTATTCA
TCCACTGCATCttcgaactcgttctcgctcTGCCAACGATCAGCTTTTGTGTCTGTCTGGACCTCCTGCGAATTTACGGCCATGTCCTGGTAAGGACTCA
TCTCTGGTTCGTGATCCCCCACTAACCCTGCCTCCTGGTGGCGATATTCGCTCTCCTCGCCTTCCCAATATTGTGGTTCCACCAGATCTGTTGGATatac
agcagcttcgtccgtCGCCACCGGATAGGAACCAACAGAGCCCTCATCGACTGCGCTCTCTGCACCCTCATACAATTTCGGGCCAGCGGATGAATTGTCG
ATCATCCCTGCTTCGGCCACGGCTTGGGCTGCGATCTGTAGtgcctccttcagcgtcacgATCTCATCTTTATACCCACGTAACAGTCGCTCCAGCCCTG
CTCTCGACTCATACTCCAGCTTGAGTGATTCATGAGCTGCGTCCTTCTGCATCCGAACGTGAAGCAGTTTCTGTAGCACGAGCCATTCTGTCAGAACTCC
CAGTGCAAAACTACGGATCTCTTTTGCTTACCAATTGCTCGTGCTCAAGTAATTCCCGTGTCGTATCGTGAGCAGCGCGTTCCTGGTCAACAAGTCTTCG
GACTACTCGTAGCACCCTCCAAACACGCAGAACGCCTAGTAATCTGGCGGCTAAATCCAAGACCAAAGTCACGTTAGTTTCCATACCTACTACAAATTGG
ACAATAGCCCTTGCTTACCTTTCGTCTGCGCATACAACTCCACAGCGACAGATAGACTCACCACCACGAGATCCAGTACGTAACCTGTATGAGAGAAGAA
TCCACGTCGAAATGCAGCCAGCAGGACGGCTAATTCGATCAAAAAGAGGAAAAGTGTGAACCCCGTGAAGGATTCCACTAATCCAGTCACAATCCGCTGC
AACAGCGAAGCTGCCACCTCCGTTGTTGCTGAGCATTtgctgtggagctgctgttggtcGTTCAGATGAATGCCAACAGCAGTGCACCCAACGTCTAGAG
CAATGAGAACGACCATGGCCACTTGAACCTCTGTCGTCTCCAAAACTGCCCCCAGTGACTTGAATCGGGTGACATTTTCGTCTCCGTCAATCTGTTTCGC
TGCATCTGCCTTGATCTGTCGCTGTTTCTGCTtccacgacctgctgctggtactgctattgctgctgcgtgtgctaACGGTGGACTCGGCGTCGCTCGTG
ATGCCCCGAGCTGTCGACTTGAGCTCTCTAGTCTtacgacgagcagctttgtgcttctccatcaactGCGTATCTTACCGAGCACTCGAAAGGTTGTCTG
AAAGATTGGCGACTGTTTATATTGACTCGTTACGCCGCATTTGGCCACCGAAAGCGATTGCTGAAGCTTGGGTGCTCCCTACCTCACGGCAGCTTGAACA
CCGTGTTCTGTTCCAGATGCAGCACCGTCTTGGATAGCGTGTCTAGTTGGTCCAGATCCACCACATTCGAAGGTCCTCGCGCGTTGATCAGAGGCTTTGG
CAGGATCAACTGATCTGCAGTCGATACCTCCCACCCCAGCGAAGAACAGTCTGCAGCAGGCAAAAAGCAACAGCATTAGGCCACTCTGCAAGAAAACCAT
TGTCACTAGTAGTGCGCAAGCTACGCACACTGCTGAACGTCTTCGTGCCGTGAGAAACCCAGTGCCAGTGCTACGTCATTGATTGACACCGTCGAGTACG
CCATACTCAGCAACTCCGCCGCATTTTCCCGTGTTGAAGCTATCATGCAATGCATCAAACAGACAATTCCGTCAGTAAAAGATGTTGTCAACACCAATAA
CAGCAATCCACGCACTCTTTAACGTCTCAACAAGCCCCTGCAATGACGGGGACCAGTCGTAGTCCATTGCAACGTAAGCTGCCGCCAAGTTCCTATCACA
CCGCATCAATTCAAACGTTCAGCCTCGGGTTATGATATGCATCAAAGCCGGTATCTTCTCCATACTCACCGCTGCCACAGCGCCTTGCCCACTTCCCAGA
CATTGCACAGCTCCTCATGCGTTTGCTTCATCTCGCTGGGTATGCGTTTCCACAGAAATCGCGCATCGTTGAGGTCTTCGGCCAGTAGAACGACCAATAG
ATAGCTCGCGTAGAACTCCGGGGACAGCACAGTGGGCTGCGAGGGTGTTGCCGCTTccgccacgagctccagctcctcagACACGACCTTGAGTTGGTGC
ACGAGCTCATGCGCCGTCTCCCGGTTGCTGGCGGAGGCGTGGGCagccaggagctcctcgcgctgcgtcttcaggGTGTCGACCAGGTTGTCCATATTGA
GAGTTCTTGAAGAATGAACTGGACTATTAAATGGTCCAGAATAGTCAGACTATTCCTTTATTTCAAAACATTCTCCCAAAGCTGGAAAAGAGGTCAAGCA
TGGCGACGGGAGAGCAGTATTTGACCAAGAACTACGAGAAGTGGAACAACTTCCAGGTGCGTGTCATCTTCCCCAGTATCTAGTGCACTATGAGGCGGTT
GCAGTCATGCCACTCTGGTCTCCAACCGCTCTGTAGATGAATATTTACGTTATGATCTTCTCACCATTGACCTATTGTCTCAATTTCTTTTACTGCTTCT
TACGCCTTTATAATCGTTCACaggacgactcggactcggacagTGAAGATGTTCCACGTGTGCCCACTCAATTCGACGTGGAAGGCGATGGTTCGAGCAA
TAAACCTCAATGTATCATTCCTCTAGACGACCCACGAACTGATACTGTTTGCTGTTTTTGATGCCTTTTAGCCGATATTGTGATCAGcacgaagatgctg
ctgacgCCCAAGAAAGTAGAGCGCTACcggaagctggagaagaaacagcTGGAGGTTTGGCAAGTTGTGGTGCGTCAGCTCCGTGTGTGgtcggcgtcca
gcgccgGCGCCGAAGAGGGACAAGACGCGGTGCCCTGTCGGCCGTACTGCATCCTAGTGAATAACTTGTACCCACTGGGTCAAGTGGTGTCCAAGAAGAT
CTGCGACCCGCCCGAGGTGTATCCGTCGCCCCAGACAGTCCTGGATCTGACTCTGCAGGCGATGCTGGACCCGCCCACCAACACGCCCCAGCACCGGCCA
GACAAGATCGTCTTCCCGGACAAGAACTACGTTGGGCAGCTGCGCAAGAGCTACTCTGCATTGGGTATCGAGTGTTCATACCTGTCTGAATCGGACGGTA
TTGACGCTTACATCCAGTACGTTATGAGCTCTTGGAAGGAAGggagaaaaaaaaaacttctaACGTTGCTGCTATTCTATCAGGGAACTCTCGCAGCACT
TGATCCGCAAGGACCTGGCGTCGGTGGCTGAAGTGAGCGAGCGCGCAGGGCTGATCTCGGGCGCTGGTGTGACAGTTGAAGCGTTATCTGCTTTCTACGC
AGCCTGTGACCTGTACGCGAAGCTGGAGCCGTGGAACGCTCTCGCTGAACGTCAGGCGATCCAGGTAGACGCTGTaggcgacgaggagctgcgtctggat
GCTCGTCATCACGTGGGCCGAGgcaccgtcttctcgtcTGTCATCAGTACCCACACAGGCAGTGGACCGAACGGCGAGGGCGGCGATCACATCCGTGGTA
TGGCGTTATTTTACACTCGGGCAGATCTCGAGCGCCGCGTGCTGCCTCCTGGAGAGAAGCTGGCACTAATGGAGAACCCGGAACTGCGTCGCTGTGCTAA
GTGCGACAAGCGTGCAGGTCCCGGCAAGGAGCTTAAGCGCTGTACGCGCTGCCAATGCACCTTCTACTGCGACGCTAATTGCCAACGTGGGCACTGGAAG
GACCACAAAGTGAGCTGCACTCCTCCTGGAAGCGCTTCTAGCGGGGCTGGCGACCACAAAATCGTGTGGGGGGCTAAGGAGATGTCGATTCTCTACGGTC
CACAAACGTCCGTACCGTTCGACGACCTGGATGTCATTacgaagaactcgctgcCTATTGCTAAAGCCAAGGGCGAGGCATTGTACCCATCTGCTGTGGT
GTTTCGCAAGGGCGATCCGAGTGTACCTGACGTGACCGAACTAGCGTGGCTGACACGAGCGTTGAACGCGCAGATCGAGCTCATTTCCAAGCAGCCGCTT
TTCATGCAGAACACGATGGGCGAGTTGCTGGGCTTGGACGACCCTGATAAGGAGCcgcagaagctggagctgaagtgcAAGACCCTTGGATTTAACGACC
ACCTCATAGTCCGCAACAGTACTGTGCTCACCATGCACGACGTCGAGCGGTTGCGTAAGGTGATCAAGAAGCAACAGAAGACTGAAGGTGAAAGCCAGGA
AGGAAATGACGAGGCTGAGAGTGACGATGACGGCGCTGAGCTtcaggaggaagagaagggCTGCAGCATCATGTAATGAACAGGTCAGAAGACGCTTTAT
GTTGATGGAAAATTCATGAAAACATTGACAAGTACTTAAATATTCTCCTTGTGCTGGCTGATCACCACTGCGGCTGGTTGTAGACAGCACGTTGGAAGAA
TGGAGCGAACACTACAGCCATAAAGAGGAGCGTATCAAAGCGGTCTAGTGCACCACCGCCAACGCGAAGATAAGCGCCAGTTCTGGAGATCTTAGCGACT
TTCTTGAGGCTCACGAGGAAGAGTTTACCCACTTGGGCACACGCAACTGCCCCAGCACTCACCAGAGCTACAAAATGAACGTCCATGTCGAAATCCACGT
ACCCAGCAGAGAGGAACGTCGCACCGACAGCAAAAGCGATCGATCCGAGCATCTTCTCGACGTTTTGTTGGGAAGACACGTGTTTGGACAGGGGATGCGT
CCACGGGAACTGCACCGCCTTCAGTAGCCGAGCGGTAAGGAACGCGCCAAGCTCAGAACTCCACacaatgacgaagaaccCGGCTAAAGCTCCACTTGAA
CGCACGCGCATTGACTGttcgaacagctccagtactGCAGCGGCGCAGCTGAGATAGACCAAGCCAGCTACATCCAACACCATCATGAGAGCCGATTCCA
CGGCGTCTTTGCTTGTAACAGCGCgcacaaccagcagcagacacacgCCCAGCAGTAACAGCGAGTAGGACTCGACCGCCACAGCCAGATACTTGTCCAT
AGCGCGTCGACTGTCTAATTCTCCACTGTAGTCGTCGACTGAGCCACTTCCAGTGCTCCCGCCCGCATTGGAGCTTGGATCACTCCGTAGCACCACATTC
AGCGAAGACAGGAAGAAGTACGCGTACCGAATCAGTACGCACAGCGCTGTGGGGGTATTAGGAGACATAGTCGCCGAGAAGACGCCCACGAAGGTGCTCG
CTCCAACGTAAATCATTGGCATCTGCGTAATTCCTGGCAAAAAGCACAAACCCACCGAAGCTCCGGAAGCCAAAGTGGAGACCACCAGCGCTGCAAACAC
TTTACTCCCACAGAACAATTTCTCAGCTATCGGCGTCACGGCTGCCGTTTCCTCGTCCACAGCGTAAGCGATGATCTGTCTGTACATTTCCCTCGacgtc
tgcttctcgtgcAACTTAAAGGGcatgaagagctgcagtcTCACGCGATAGGCCAGCCACGCAAACTCGTAGCCTGCGATAGCGACAAAGAAAGCGTACA
CATAGGGAAGAGCTCCTCCGTGACGCTCTCCACGCTCAATATCCACGGGCACGTAAGCTGCCAGCACGacgccagctgcagcagctagTAACAAGACGGA
ATCGAAGCACAAACGAAAGATCtggcagcagttcaagcgcTTGGaaaccgcttcttcttcatacCACGACGATCGACCGATCTCCTCCGACATGCGCTGG
CCGCGTAGCATGGCGACGGACGATCCGGGCCGCAGAATCACGGGGCTGTCGTCCATCAGGTCGGGGTGCGCGTCCGACGGGAAGCTGGGGATGGAGAACA
TGCCCCCGCCATCGCCCAGGACTGGGTGTGGGCCCGTGCTGGGGTCCAGCGGACGCAGTCCCATCATACTCATGGCCGCTCGAAGGTTTGGGGCGGAAGA
TGGAGTTGTGTCCGAGCGATTGCAGGGGCATGATGAagcgcgaagagctgcggagctgctcgctggaAAGGACTGTATAGTGAATTCAAGTGATTGTAGT
TCAGCACATTCTAGAGCACCGGCTGTTAATTGTGCAACTGCTGAGCAACGTTATCGCAACTTCGTTATCGCAACTTAGAAAGCTGCAACATTCTAACTTC
A