Description :
From Genome Similarity Track
Location :
Scaffold_658:202- 1384
Transcript NameFunction/comments
Phymu_g11397hypothetical protein PHYSODRAFT_295343

Sequence
1182 bases(100 bases per row)
tttaaaaaaatataatAAATGTAAAACTGTCGGCATAATGTTCTATTAATTTTTTTATTCTTATGACATCCAAGATATCAAAAAGCGTTGCGTCTACTAA
CGTGAAAAACTTCACTTGAATTAATGGTTCGCACGGTTTGCTCTACGTCGAGCTCTAGCACTTTCAGCACGGTGCCATTCAGCATGAGCAGCAAACGCAC
CGCGTCTGTTGAATCGTTCTGTGCATCCATGCTCTGGGCAAGTCaaatcaacttcttcttccgatGACGATCCGGATTCCTGGTCCAACACATCGTCCAA
ATCTTCGCAATTAAGAGTGAAGCCAGGAAGAACGGTACCACCATCAAGATCTCTCCACGCGCCATTGCCAACGCGTCGAACAAGACGATTTCCTTGGGCG
TATCGCTTGTATTCGTACATGATTTTGTTCTTTGGATCAATGAGCCATCCCAATTGCACACCGTGAGGAAAGTACTCGCGCCGCATCTTGCGATCGAGAG
CATCAAGCTTGGAATGTGGACCAGTGAGAGTGTCGATTTCCACCACGAACGTCGGAGCAAAAGGTTCTCCACCACGAGTCCATCGTTGAGCTTCGGTCAG
CCGCCTTGCATCATCTCGAGGCACATACGCCACATCGGGGACCCGGAGCGTTGTGCCATCCAGCACGTATTCACCTTGCGCATCTGTCACTCTTCCACCA
TGGCCACTCCACGCAGCccattgcagcagcgcgtggcaGATGTATGGTCCGATTACGCTGCGCCCGAACACCACCATCCGAAATGGAACAAATCGGcctt
cgtcgacgaagaagccagGCTGCTCGCCAAGTGTTGGATGGACCAACGGACCGACCTTCTTCACGTGTTGGTTTAGCTGCTCGAGGGACACACCAGCGTA
GTCCTTGACACGGCACAgagtcttcttcgactctAGGTCACACACCAGTCGCGCAAGCATGTCTTCGTggtctttcttcttgccgtttGCTGCGGTCATG
GTTGCCGATGTTGTTCTTTCTCGCACTGGCAGAAGCAAACAAGAAAGTCCTTGCCCAGTGTGGTCCACGCTACGAATGAATTGACTTCAAATTGAATTGG
TACTTCCACTAAATGATCAATTCAAATTTGATTCATCAGTGACGGCTCCGAGAACTAGTTCCATACCCAGGAACCGATAGGT