Description :
From Genome Similarity Track
Location :
Scaffold_1946:202- 1320
Transcript NameFunction/comments
Phymu_g13774hypothetical protein PHYSODRAFT_258359

Sequence
1118 bases(100 bases per row)
AACAATCTACAGACCAGGGTGAACGCCCAGGTATCCGGGCGTCGGCTCGCCCTGCACTTCTCCAAAGTACAGCGCAAACGTCTGCTTCAGTGCCTCCACC
TTCGTTCGGTTAGCCATGAACGTAGAGAAGGCGTCCAAATTAGCCGCTGGGATCTCCCAAGGGTGGGTCGATCCCGACGGGGCAATGTCCGTGCGCACAG
TCTCCATCACCACCGACTCCTGCACTTCCGTAGACAGAATCCAGTTCGTGAACAGCTTGGCAGCCGCAGGGTTCTTCGCCTTGTTCAGAATAGCGAGACG
CTGACCCCACGTCAGGTATTCCGTGCCGTTGCCGCCTACGTACGTGATCGGAGGAGCGCCACCGTAGGTGCCAACACCAATAACCTTCTCTTGGGCTGTG
ACCAGGTTGTTCGCGACGTGCGAGCcgcggttgaagctgatgctTTGGTTGGCCATAGCGGCAGCCCACTCCCAACCAAACTGCTTCACATACAAATGGT
AGACGAACAGCacggcgtcgtcatcgtGAGGGTACGACGAAGCGATCTTGCCAGCCCATTGAGGATCAACTAGATCAGCCGGCGACGTCGGGGCATCCAG
TCCACCGAGGTTGCTCGAGTCGTAGATGTAGCTGAAAGAGTTGACGCTGTACGCGAACCAGGCACCGCTCTCGTCCTTGAGGCTGTCGTAGATcttggag
aagttggcgGGCTTGTACTCGAGCAGGTCACCCGCGCTAGCCCAACGAGGGAAGTTCTGCACGGTCTGCAGCGCCGTGATGTCGGGGACGAGTGTGTCGG
TTTCAAGCTGGTTGTCGATACGCACGTCGTGGTacttgctgtagtcgacGACCATGGTCATGTTGATCCCTGGGAAGGCTTCTTCGAACGCTTCCTTTAG
CGAGTCTTGCTGGTTCGCGAGATCGCCTCCATGGTAGAAAATGAGCTTGCCGCCTTCAGTAATTGCGTCTTCGTAGAGCTCAGCAAGCGTCTTGgtctct
tcttcgacagcGCAGACGCTCGAAACCACGAGGGCGAATACAGCAGCGAATGGTGTGTAGAGTTTCATCGTCGTAGGAAGGTTGGACTGGTAGGCACCCG
TCAATTTGGAGAATGAAG