Description :
From Genome Similarity Track
Location :
Scaffold_1093:2019- 5282
Transcript NameFunction/comments
Phymu_g12720hypothetical protein

Sequence
3263 bases(100 bases per row)
AATGAGTAGCTTCGTCTTTTTAGTACCAGTAGATATTGGTCGGCACCAAAACTTTCACCTAGAGACAGAAAGTCCCAGTGGAGGGCACCGTTCCGTTAGT
TCGTTCGGTATGTTTCCCCCCATGGGCTTTGTGCAATTTTGATGCCCTTGGCATGATGACACAGCAGGCACGCCGATAAAAAGGTCTCCACTCGCGCTCT
AAGGCGGACCAGGTAAGCAAACCTTCTAATCGTCTCCATTGTAGCGTCACTACCACGGTGTCCTTGTGCTGCACAGTGCGCAACAACCAATATTCGTTGC
ACTAGACATTCGTCTTTATCGGGAATCCATAACTTATCGTTCATGTACCACCCAGTTTCGTCATCACCACTAGCGCCTATTGGACGATCTTGCCTGTGCT
TCATTTGTGGCTCTATTACTGCTGACCGACTTGGCCATACGAAATTCGGGTCATTAAGGGGTCGAATTGGTAGCggaggtggtgcagtagTCGCCGTTAT
TGCTCGTGCTCGCGGAGCTTTTCCATTTTCCGACGAGACCGTTTTCTTGGCGGAGCCACCTCGCCTTCAtttgtcgctggagaacgcTTTCTTAGCGTCA
TTTGCCGAATATGTGTTGCTGGTTGGTGGTTCTCCGCCCATCTGGACACCATGTCACTCCACACGTTTCTTGTCCTCTCAATGTGTTCGATCTCGTATCG
GTATTCTGCTAGTTTCGTTGCCCACCTCAGTAGTTTACCCCTTATTTGCTTTTTTACTTCTGCACCGGGGGCGAATACAAAGATGAGTTTTTGGTGGTCA
CAAAACAGTCGAAAGCCTTGTTGTCGTAACAGCAAGTAGCTAAGTTTTTCGCACCCACACACAATTTGGTAGGCTTCTTGTTCTATAATGCTCCAATTGC
GCTGGGAACCGGTAAATGTGCCGCTCAAGCAAGTGAGCGTCTCGTGTTGCTGTAGGTGTACTGAAATTTCGTTTTTCCAATTCAGCACCTGACTCACGAC
GAGGCACCATCCGATGTCACTAGCGCCCGACATGACGCACATCGTAGCGTCCGCACGCGGAAACGCGAGCTTCACACTCCTGGTCAAAAGTTTTTTCACA
TTATCATACGCTGCTAGCTGGTCCGTAGTCAAATTAATGGCGattcctgctgcaactctCTTGGTTCGCTTGGACGCACTAGCAATCGCGTTATCGGACG
CGCCTTACAATGGTCTAGTCGCCCTAGCGTAATCGACCAAGGTCCCGCGCATCCAGTTTGTCGCACAGAGAAATTGCTGTAATTCCTCAGCAGTCTTCGG
GTATGGCGTCTCTTTTATGGCGCAAATTCTCTCTGGGTCATGTCTGATGCCAGAGCCCGAGATTATTTTCCCACACCAACGCACTTCACGCTTGAACAAG
CAGGAGTTTTTTTACACTTAACTTGAAACCGAAGAAATCTAGCAGTTCGAATAGTCTCTCCATTTTCACCAAGTAAATCTCGACATCAGCTGCGAAAAGC
AGTAAATCATCAATCCAGACGAGTAAATGTCGATGCATAAGCTCTTCCAAATACTTCTGTACCTTAGATTGGAAAAACAATGCGGCGTCTGTGCAGCCCT
GCGGTACACGCTTTGGTGTGTATACCTTCTCATGAGCCATGTAGGACAACGTCTCTTGACATTCTTCGGCTAATGCGAGCTGCCAATATTCTTTAATGAA
GTCAAACAAACCGAAAAATTGCGCGCCCTTGACGGCTTCCAGGTCAACTGGCAAGTCGGGCATTAGTCCTACAATTGCCTCAGCTAGTGTGTTGACTGGT
TTGTAGTCGGCTGTCCGCCGATATTCACCACATCCTTTTCGAACAGGAAGGGCTGGACACGCCCACCTGCTCTCCTGGTTTTCATACACCCAACCCAGTT
GTACTAGTTTGTCGTTGAAGTCCTTCATGAAACGACGGACTTCAGGCGGATACTTCCGTGCCTTACACCGATACGGGTTCGCACCAGGTTTTATTCGAAC
TCGTATCGGGGGCACTCGAGCAGGAGGGTCTACACCCAATCGCACTCTCCACAAGTCAAATTTTAGCGCAATACGTATCAATTCTTTTTTGCGTTCACGC
GGAAACCCTTCCGCAATTGCCTGCTCGACGAAGTCTAGCACGCTAGCCTTCACTTCATCATCCTGTAGTGCTTCACCTCCAATCGTGGGTTCGTCTACAC
TGTCAAATTCATCATCATTCACGTCGGCCGCAAGTGGTACCGCCAGCAAGTCAAGTTGCTTCTCAACGTCGATTTCCAGCCTCAGTAACAAGTCGTTACC
AAGTAGGAACTCTCAGGAGTCACCGGAAATGATAAGACACTCAACCGGTTCAGCAACATACACAATACCAGCAATAGTTCGCAACCTCACTTTCAGTTTT
ACCGTCCAATCCACAAAAATTGATGTTCCATCGGCCATCGTGCCTTCAATTGGCTCGTCCAGTTTCACTCGCACGACATCCGGCCGTACTCGCACCAGTT
TCCCGAAACAGCTTTCATCCAAACAACATCGGTCCGATCCACTATCCAAACAAAGCGGTACTCCCACTCCATCCTCAAGTATCACGACTTGACTTTCTTT
GGGAAAGCACGCTCTAATTCGTTTGAACTTAGCGTTGCCTCCCTTTGTTGGAAGCGTCGGTCTTTTTCTAGCTTTGTTCTGTTCAGTCGGAGCTGTTTTA
GCGTTATCGGCGAGTGCTTTTTCGCGGTCGGCAAGTTTTGCCATGGGGCAGTCTGACAGGTAATGCTCTCCGCCACAATGAAAGCACCCATCTTTCGGAG
CTCCTTTGGGACCAGCACGGCCATGCTGTACCTTTTTTCGCTGTGTACGACCACTGTCACTTCCTTTCTTGGTTTCTTCACCACTCGGGTTTCTTGGTGG
GCATCACTCTTTAACTGCTTGgccctccttcttctgaTCACTCTTGCGTTTGGACGAATTCGCCTTTTCAAGGCTTGCTCTTCAATTGCTTGCTCTTTAG
CCTTTACTCGGACGAGCTCGTACAGGCGACGAATATCCGTCTTGGCTTCGGGCACACGGAAGTCAATCTCATTCAGGACTTCGCCCTTTAACCCCTTCGG
TAGCGAGCGGACAACTATCTTACAcctctccttcttgccacgATCCAACTCAAAGAAACGGGTGAACCCATACTTCTTTATCAACAAGTTACACAAATGA
AAGTAGTCGATCACTCCCGCGTCGATGTCGATGTTGTTCAGGTCCATGCGAAGTTCGGTGCGG