Description :
From Genome Similarity Track
Location :
contig_123:20184- 43131
Transcript NameFunction/comments
g13488.t1hypothetical protein
g13489.t1hypothetical protein
g13490.t1hypothetical protein
g13491.t1XP_009536935.1 hypothetical protein PHYSODRAFT_565346 [Phytophthora sojae
g13492.t1OWZ08121.1 Equilibrative Nucleoside Transporter [Phytophthora megakarya
g13493.t1hypothetical protein

Sequence
22947 bases(100 bases per row)
GACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAAT
TAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCC
TGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACC
AGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGA
ATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATACCATGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGC
TGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCA
AAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGCTGGCATA
CCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACTGGTGACTCCAATAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCC
CGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAA
AGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCA
ACAATTGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACTTCGTCCAGCAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCGTTGGC
GTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCA
AAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCC
CAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGA
TTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGA
TCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTT
TCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTAC
GTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTC
GCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATT
TCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGT
CGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCGTGAGAGGGATATCACTCTCACGCATGA
GGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGTGC
CGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTC
GATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACT
TCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGAC
CTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGC
TGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGCGAAACGCTTCC
AGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATTCAGCCTCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGAC
ATTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGC
TTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTA
CCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTT
GCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGTCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACAATTGTGTGTCGA
CATTATTGTCGACACTACGACACTACCGCGTCGCCCGGACGCTTCGAGACCCTCTCGAATCGGATTGAACCAGGCCCTGCTGATTCGGTTCACATCTTCC
CAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTAGTGGAGGGCCGCATGCACCACGTGGTGCATG
TGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCA
AGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGTAAGAGAAGCGTACGCGTAC
GATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCT
GCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTC
ATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGC
CCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCG
GGCATAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCGGTCGCACTCGAGAGGTCCATTGGT
TCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAG
CGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCC
TCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCG
CCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACCTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTC
CGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCAATGGCAGTGTCGACCT
CGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGA
AGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCC
GCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTG
GGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTG
CTACCAGGTGTAATGGGTCTGTTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTTAGTATA
CTTGTATCCACAAGTATACTTAAACCTAGATAAATGAACCAAACGGAAGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAA
AACTGATATCTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGT
CATAAGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATCCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGAATGTGTA
GCCCCGTTACAAAATGCTTCATCATAAGGTAGTAAATAGTTAGTCAGTGTTTCCTGGTAGTTGAACGAGTTTTGGGCGCCACCAGAAACTCCAACTTAGT
CTTGCCTATCGAGGAAATCCGCCACCGACCATGCCGGATTCCCCGCCATTTTGGCGGCTGAACGATATTTTGCATCGTAGGTCATGCAAGTAGTACTGTA
GCCCGTCCCGACAGTCAAGATTGTTTTCTTCATCGGAGAGGCAACTTCATCCCAATCGGTCCGAAGGCTCATCACGCTTCTCGCCCACTTTCGACGGGGC
AGCTTGTGGTAAACTTTAGCTTTTGTGTGGTATTGTAATCCACAGAAAACGTCGTTAGTGCGGCTTCCACGTAACAACACAACAATTCGCCGAGTCAGGT
CGCGTTGTTGGGCTTGCGCAGAGTTCTGTGGTTCCTTGGTTTCCTTTGCGGTTCAGCCCAGCCGGGTCCAGTCGAGGCTCTGTTTTCGTGAGTACCAATC
AAAACTCCAGAAGCTCGCCTGAGCGGGGTAGCTTCCGTTCTTCAAACCCTGTGACTTCCATCAAAGGATGGGCGTCGGCGCGCTAGCGCTTTTACAGGTC
ACGAGCGCAGAGTACGCTCAGCTAGAAGATTGCGGTGTCCTGGTTGTGCAGACCCACCGACTCGTCGATTCGACGAGGTTTGTCTTCGCTGGTAGCGAGA
AGTGCCCACCCCGGGCCGACCTTGATCTCTTGGCGCTACCAGTCGATTCCCTACAGCTATGCCTCTTGGGGAATGACGGCAGACATAATCCAGCCCACGC
AGGGACTTACCGGAAAATATACGCTGTTCTTGGACTTAGAAGATTCTGCTCTGTTTTGTTATCTCTGTGTCTTCAGGAGTCCTTTCGGGCTCTCCCCTTT
GGTCTCCTATCGATCCTATTCAAATACCCAGTGAAATGGAGTCGTTCTAGATCTCCCTGTGACTCTTCGCTCAGCTTCTAATTGATCCTCGCCGAGTTGG
GTCGTTATGGATCTCCGCCGACCTTCACTCTGATCCCTGATTTATCCACTCCCACTTGGAATAGCTCGCAAATGGTATACGCTCACTGAGTTCTGCAGCT
CGCTGAGTCTTTGGCCTCGCCGAGTCCGTCGCTTGCTCAGTTCTTCGCTTTAGTGCGTACGCTAATTAGATACGATGTATCCAACTGGGCCAGACCAGGT
GGTCCACACAAAATATTGAGTTTCCATACACCACATTGGGGTGCCGTTGTGCTTGTCGTAGTTCAGTTGGGACATACTAACAGAACTGTTGTCCCTGTGA
AGATCAAGATTGGCGAGGAGCATGATAGCTTTGAGATGGTCTACTCATTAGCTGAGGCAAAGGTAAGCGGTGGCGATACAGTTGTAGCGTGCCGTCAATT
ATGATGTGGTGTTCACGGCTGGAATTTAAGACAAGATCGCTCGTACGGACTCACCTTCGTCGTGCCAAGTGACAACAACGACACTCGACATTTTCACATT
CCGATTTTCTTCCCATGCAAACACATCGAACTTTCCGTAGTCCAGCGCCAGTGGTAGTGACCATCACACTTTTAGCAGAGCCAGTGCGTTTCCGCTTCCT
TAGTTGAAGCGTAGGGCTGTGAGCCCACCTAAACCATCGACAATGCGTCCACAGTGTGCGCACTGTCGATGGTCTGGGGGTATTATGCTGGGGATATAAA
TGCCTTTGACCAAAGACAAACTGCACATCGTTACAAAGTATCTCTGTAGAGGCCTCAAACACATTTTTGACAGTGTACAGTACTTACGTACAGCGTAATA
CAATGTATTGTGCTGTACACTTACTCCGTTGCTTCAATAGTTCATCGGCATGTACCTGTACTCGAAGCGCGGATCAACCGACTATCAGTAGTGTGCAGCG
TAATACACTCTATTACGCTGTACACGACTCATGTCGTCGACATATACTAGAAGCACGGATCAAGAGCCTCGAATGTATCACTTCCGATTTCTTCGCCATG
CAGACACGCCGAACTTCCCGTATCTCAGCACCAGCGATAGTGATCGTCGCACTTTTGGCGCTTGCAGCGAGCACCTCTGTCACCTCGGCAGCCAAGTGTT
TTCTACTCCAAGTCTACGAGCACTCCTTCTCCTGGTCTACATCAGCACCCGACGTCACCGAAGCGCCGATTTTGGAAGACCCCACACCTACCCAGACTGA
TTCGTTTGGAGCTAGCCAGGCGACCGACGGAAGTTCGTTCCAGGCACAGAGCTCAACCGAAGCATCAGCAACGCAATCCGGATCCTATGAAGCAACCCAG
ACGAGCGAAGACAGCTCGAACGCTGCCCAAAGCGCAACTGAGGGATCGTTCGAGTCGAACGAGGTAGCCCAAGGAAGCTCATCCCCAACACAAGGTTCGT
CCAGCGAATCGACCGGGGCTGTTCCATCCACACATCATCGGGCGTCCATGCCACGTTTGGAGACATCACCTCAGCCACTGGCAAATGCGTCATTGGTGAC
CCGAACGCGGACCTCACCCGCGAGGATGTGGACTGGGTCTGGAAGAACACCATGGAGGAATACGTCCCGCAGTTCAAGAACCTCATCTTCGACCAGCTCG
TGACCAACAACGGCTCGCTCAGCTACTGCGTCCGGTGGGACAACGACCTGAAGCTGACCAAGTCGGTGGCATCCAAGTTCCAGGCCATGATCGAAAAGCA
GATCAACCTGTGGAACCGATGGCTGGTTGGGTACAATTGCTGGCCGATCGAGAAGATTGACATCACCGTCGTGGGCTTCGCAGTGCGCGACAAGTCCATC
ATGGACTGGAGCGACGACTCCCTGGGCACGATCTACGAGGGTATTCTGGACGCCGAAGGCAGTCCCCAATGCCCCGACGAATGCTACAAGCACAAAGGCC
AGGCTGCTAGTGCGGATACAAGTGCGTGCAAGGGCAAGCCGTTCGACATGTCGCTGTGGCCGTCGACGAAGCCTGGAGACGGCGCCATTGGTACGGGTGG
CGACTGGGGCCAACGCGTTGAAGTGAACGACATGCTGGGCACCATGGACGACGAGGAAATGGTGGTTCTACTGCACGAGATGGGTCACGGATTCGGCTTG
CCGGAGATGTATGTGGCCGAAAACAAGCCCAGCGGCTACCCCGCCTGTGTGATGGATGAGAGCTCACGCTCACCGACGGTGACGGGTGGTTGGTGCGTAG
TATTCTGGAGAAGATCAAGTCTCGCTATGACTTTTAGAGAACGGTCGCGCAACCGCATCTTTGAGTCTTGTGCGTAGAACATGTCTGCTGTTTGTGCAAC
GCTTCAATGGATCCACCTTACGCTCATTTCTTACCTTTTGAGACCCACGTCGGCCCCAAATGGCAAAAGCTGGAACGACGGGAATAGTTCCCTTTAAGTG
AGGTACATCGATGTCACAAAGTCATCCTAATGACTATTCTAGTTATCCTAACGACTATTCTAGCTACCGTCCTATAGTCGATCTCCATCTTTCCTTCGGT
CCAAATTTACATTTCCCAGGACGTGTCGCTCGCTGACAAACTTGTCCTCTGACTCCCTGCAATTGCACCAGATGCCTTTCACTATCCTGTACTACTTCAT
ACCAACGAAGGACGAGATGCCCAGTCGATGCCGTCTATTGAATGGGGGAGCACGCTTTCTATGTGTTGATTACCCTCTTTCAGCCTACTTGTCCGTCTAC
AGTAGCAATTAGATCTTCTTCGTTAGCGACATGAGACACGGTGTTCGTCCACCTCCCCGTGGATTCATCCACCAGCGCACGACAGCCTTCGTGACCTCTT
CAGGCTTCTCGTGGTGGATGCAGTGTCCCGCGTCATTGACCACGAGGTGCACGCTCCGCTTGCTAACTGTGTGCGCCAACTTGGTCTGAGCATCAAGCCA
CTTGCGCTCCAGATCCGCAAGCGTTTGCGGGGTCACGCCTGCTTGCATCTTCATGCTGTCAAACATACCAGCCTTGCATGCGAGAGCACGACGCACGGGA
ACTCGAATGGCGTGGATCCAGATGCAGCGTCCCTAAAGCGCTGCTCCGTCTGCGGATAGCCTCGTTCTCGCGCAGTGCGCCTTCACGGTGCGCCGGTGAT
GGCAAAAAGTACTCCACGTACGGCAGCGCAACAGGAGAGTACTTGGCCGCTGACTTGGTGTGCTGCACCACGTTAATCAGTCGAATCAGCCCCAGACGTG
ACAGACGCAGCACCATCTCGCCGTTGGTGTCCATCTCCGACAGCGACTTGTGCACGACCTCCGACACGCTCTCCAGCTCGCCACGCAGGTTCTCTGCCAA
AACAAAGCATCCATCAGCGCATGGACTGGACCCCACCAGTTCACCACCAGCTTACCTTGCAAGGCGTCAACCAACACCAGCCCCTCACACTTAATGCTGT
GACCTCCCGCCGTCTTAAGCACCTCAGCCAGCTCCCTACAAACCCCAAAACTCCACATCAAACCACCATCCCCAGCACGTATGTCAATTGTCCACCGACC
TCATGTTGTATCCACCCGCTCCATGTGCCACCAGCACCACTTTCCCCGTCACATTCAACCTGTCCAGAATCTGCTTGTACTCGTCCACGATCTGCGTGGA
CGTCCGTGGCTGAGCTCCAGGCTTGGAGAAGCCCAGCCCTGGCCGGTCCACGCTCACTACCGTCGCGAACGCGGCCACTTCAGCCGCCACTTGTCCCAGT
CGAAGGACGTCTCCCCCACGCCGCCGTCGAACAAAACTGTCACATCTCCGCCGCCTCGACGCTGCACGTGGACATCCACGAGCTCTCCGTCCTGCCCCGC
GACCTGCACCATGAACCCCGGCGGGTCCATTGGGTTTAGTGCCTTGACCGTCTCGATTACGAAGCCTCCAGACGCGATTAGCGCCGTCGTGACCGCCAGG
CCGCCGAACATGAGCTTGCCCACCTCCTTGAGTTCCGTGAGCACCATCTGCTTGGTGGGCGTACGGGCGCTCGCGGCGCTGGCGCCTTCTTGGATAATCC
ACGCCCATGACCCACAGGCTTGCGCGAAGAGCGAGACGCTCCTGGAAGCGCACGCAGAGCCTCGAGGCGATGGAGACGTCCCAGCCGCACGAACATCCTA
GCAATTGATTCGCGAAGTGAGACTTTTGCATTGTTGAATGGGTCGTACTTTATTGAACGGCCACGGTTCTAGTATTATATCGTGGCTGCATTGTTTGGTA
ACCTAGCAAGAGGTTGTCTAAGGCGAGTCCTACCGTGGAGCCAAGAACGAGTCCCAAGATCAGGAAGAAGCTCGTGCAAGGGCCGATGAGGTGCTGCTCA
TCCGGCTGCACGCTTTCGCTCACGAAAATGATGGTTATGGTGCCGAAGTAGCCGTTTCCGAATCCGTGGAGCACAACGCTGAGCACGGACCAAATGTCGC
TCTGCAGCCACCATTCCTGACGATGCCGATGATGATCGGGACCAGGATGAATCGCGCGAGAATCGGGACCAGACGTTGCTCGGGGTGAGACCGAAGCGAT
GGTTGACGATGAAGCGTCCGATGCAGTCGCTTAGGGCAATAGGGTGAGCAGGATCAGCGACCACCACCCGTTCTCCTGGAGTGACGGGAAGTTATACGTC
TTGATCTCTGTGACGAGCGGCGGCCAAACTGACAGACTTGTGAGGTAGACTGCCAAAATAAGCGCCTCCAAGTGCCACACCTTCTTCAGGACTGACAGCT
TGGTAGGTGCGGGACCAACAACACCAGACAAGTCGCTTCCGGATTGACGCCTGTCCGTAAGCGCAGGAAAGTGCTGCTTGAAAGTGCTGCCCCCTTCTCC
GAGCAGGTACTTCTTCGTGATCTGCAGTTTCATGGCCTTGTAGAAAGCGCCGATGCAAAGTGCAATTGTGAGCGCACCCGTGTAAAAGTAGATGAGCGAC
GACGCCAAAAGTTGGTCGGACGGGAACACCAGCTTGGTCAAGTCGCGATAGAGGCTGCCGATGAGCGTGCTCAGTCCAATGCCCAACTGGAAGCTCTCTT
GAACACGCTGCGGGTAGTGCGACACGAGTGCGATGGCGGCACTGTCGATGAAGCCTGTGGCAACCGCCGCCACCGCCGTGCCACCGAGCACTGCAACCGC
GTTGGCGTTCTCGGACGAGAGGAAAAGAAGTAGGATGGGCACGAAGGCGAGCACGAGCAGCTGGCCGATTAAGCCGCCTGTAACTCGTCCAGTGTACTGG
AGATTGCCGAGGAACATGACGGTGAAAGTCAGGGACGCCAGGTTGGTGTACAGGTAGATGGAAGTGATTGCGAACTCGATGTTGTAGTCCGGGAAAAGCA
TCTTCCAGTAGTCGACAGGCTGCGTCAGCGCTGAGAACGGAAAGAGGTAGCCCACACCCACCAGCATAAACAACCAGCAGGCCAACTTCTCCTCACGTTC
TTCGCTAGCGACGCTCTGCGGGTGGCCTTCAGCATCTGCGTGGTACGCGTATGCCGAGAGGCGGGGCTCCGGGGAGGAAGGAAGTGAGGAGGACATGGCG
GTGCCGCCTTCAGTTTGAAAATGAGGAAGTGAAGCAGCAGTCGCTGGAGAATCACTGGTTGGCGCCGCATAGTTTAACACTTCCAAGTTGTGCACTCGAA
GTCAGTCATCCGCGTAGTAGAGACCCTTCATCACTTCATCCTAGTATTGGCTGGCCTCCCGCGATTCATGGTAAGCACGGGTGTGCTTACACTGCAAAGC
ACGCAAGATGTTGCCTTTTGCATAGCCAGGAGCATCGTGCTGCGTGAGCAGCTCGCACTGTGATGATCGTCCCCGTTATAATTTCATTCGCAATTCGAGG
TGGTCGTTGGTGTCCATGATCTCGATGCCCAACTTGGGTAATGCTCAAGTCCTCATTCGCAACGAATCGTTGGTGACTCCTCTGTTGAGCTGGTACCCGC
AGCTGTACTGCCTCATGCGTACTAAGTTAGACCTGTGGCACAGGCCACACATCAGTTTGGTAGCATTCATGTTGAGTTGTCGTCCGGGGCGTCCCATGTT
CAAGCTTCACGACGGAGGCATTGCTGGTCGATACGCTGGCATTACACCCCGCAGCCTAGCAAGCATGGACGTTTTCATACAGCGTTTAAGTCGAGAAGTT
TCGTACTGTATCTGTCCTGGAGCCTTGCTGACCAAAAACTGCAAGACGTTGAAGTTCGCGAGCCAATCAGAGGAAACAATCAGAGGGAATCCGTACAGTA
GCGGCTACTCGAGCTCTATCGAGCTCTTCGCGCGCGAGTTCTCTCAGCCAGCAACAATGAAAGCATTAACTACTATTAATATGCACTAGCCAAAGAGCAG
AGACTGAAAGCGTTGAGCAAAATATACTTATGTTGTGGCTAACGCCAGGCTTCACTTGTTACACATAAACGCTTGGAGTCCAACGAGTGCTGAGTTAATG
CTGCGACAGCAATACTGAAGCTTTCGGTGATCCACTTCGAATGCTTTGTTTCCATCTCCGTCGTGGCATAGCACGTTCCGCGTTTGAACGAAATAGGCCA
TGTCTTCGTCTAATTGCTTGGCTTCGTCGTCGCTACAGCTCTGCATTAGGTTCACGGCAAACTGTCGTTGCTTGTTTCGACTGACGATATTATCTGCTTG
CAAACCACACATTAAACTCTTTGGTTCAGAAATGATCGTAAAAAAGCAGCCCGTTTCCCACCTGGGCTGGTTGAGTATCGCCCGGCGAAGAGTTGGATGC
GTTTTTCCGTAATGCCACAAAGGCGATATGAATAAAGTTTGAGCTTGAATTCGGCGCTCTCTCGCTCCAACTCGACAATTGTTTCCTTGGCCTGTTCGAG
TTCGAACCTTAACTGGTCTTTACGACGCCGATTCGCGGCACATTCTCCAGTGCTTCTTCCTTTTGCTGATTATACTCGTCCGAAATGTACTTCCATCGTT
TAGCAGCTTCTGAACATTCGTTGAACTCAATTTGGCCCTGTAACGCACGGATTGCACGGTTGAGTTCCATCGTCATAGCTTCTCTTTCATCACGCCAAAT
GTCATTTTCTGCAGAATCCTTTGCACGTTCCTCATCAAACGCCATTCGCACTGATGCTCCATCTTTTTGTTGAGCTTCATTTGAGTCTGTAATCGCAACC
CTTCTTCAAGCTGATCGGCAGCTTTTGTCGCCAGGCTTGTTTTCTCCTCCTCCAATTCTTTTTGTTTTGCTGAAAGTTTTTGCTGCTAACTCAGTGAGAT
CCGATCGAGATTTTTGTTGGTCCTCGCGTTGCTTGTCCAGGCTAGCTTTCAGCACAACTAGCTCAGCGTGGCTGAGACTAGTTTCCGTTTTCGCCGACTG
AGACTCTTGTAGTTGTTTAAAATCATGCTTCACGGACTGTAGCTCATTCTGGAGCTCGGCCACACTAGCTAGACGCACAACATCACGCTCCTCCAAGTGA
ATTATCTTCTTCTTCAGCTCCGCTTCCGTTTGATGATGGAGCACTTTGCAGTGTGAAAGCTCCTCCTGCCAATCTTTCTTCGTCTTTTCCTTGATGTTGG
CGTCTAACCGACGTTGCTCTCTCAATGCTTCCTTCATTTCCCGCACGAGTGACTGCTCGAGCGCTTCCAGCTTCTTTGCGTGGCCCTTAAACGTAGCGAA
GTGTCGACTGCGAGCCATCCGCAGGTAGTCGACAGTTGTATCGCACTGCCGGGCGGCTTTGTACGAAGTCGCCATGAGATTTTTTTGCGACGCGGACAGT
CTGAACGGCTCACACTTTAGCGGCGCCATATTGACGATGTCCATGCTTGTCTCGTTCCAATTTGAGTTTGAGTGCGCGGCACGCCTCTGGTAGATCTTCC
AATGTGAGCTCTTCGTCTTCAAAAGCAATGGCGGTGTCGTTCTGTTCATTCGACGGTGGAGCCAAGCTGGACAAGCAACTAATGCTACCGCGACCAGAGT
TTTTTTAGGATGCGCATCAGGAGAAATGATGCAGGTGCTACACCCGTTTTTCCAACTGCAGTCGTATCGGGTTTCTCGGCTCTATCATGAGTGACGACGT
CTGCCTTATGCCTGTTCAAAACGTGTAATACATAAACGTTACAATCCTTTATCTAACAATATGTATTGTACCCACCTTACCTCTTCCCCGCAATCTCGTT
CGCATACGCGTTTTTGCGTGCTCGCTTTCGTGTGTCTCTGGACTCGGGCGGATACCCAGGCTGTGGTATCTCCGTTTGACTGGTCTCTTGACGAGGCTTG
GCCTTGGCGTCCGCGTCCGCGTCGTGAGCCATGCTGTCGACCTTGGACTCTCGAGATTAGCAAAGTGAGAAGATGAGATCAACAAAGTGAGAAGACTGGT
GGATGATTTTTTTAATATATCGGATGTAGGGGGATATCATAAATAACAGGAGAAATGTGTGGATTACCCAATGCCACCTGTTCAATGGTTGTCCATGGCT
ATTATTTTACTTTTCGTACACCTTATAAAGGTCCTAATTACGCGCAAAACTTAAGCCCACGGCTCACGAAGTCGTCATAATCCTGCTCCAGGGCGTGTGC
CGATGCAAGATGCATTCAAGCGGCTGATGGCCCCCTGCCTGCCACGAGTGGCGCAGGTGGACGCGGGGCTGGCGGCAGCGGTGCTGGTGGACGAGGTACG
GGTGGTAGGCTGCATGTGGGCGACTGCGTGGCGTCGCGCTGATGAGCGCGGCGCTTCCAAGAGCAGTAGTCTACATTGGAGCGACTGGTAGTCTATTGCT
TACCCCAAGCAGCACTGATAAATGAGGGACCGGTGGACGCGGTGCTGATTGCAGGCTTAATTCGGGTGATTGCTGAATATCACGCTGATGAGCGTGGCAC
TGACGAATGTGGTATGTGGATTTTGGTAGACTGGCAGCCGTCCTTCCTGCCGCGAACGGCGTTGATGGTCGCGAGGCTGATAGACGCGGTACAGGTGGAC
GCCGCACGGGTGGTAGGGTGTATTGCCGACTGGTAAAGGTAGCGTTAATGATGAATACGTGGTGACAAGAACGGCAGGCTCTGGTTGCCCCCTGCCTAAA
ACAAGAATGGTAGCGCTATTAGCAGATAACGTGCAGTGCGTTATTATATGTGTTGTGTAGCCTTCCATGCGTTAAACGCGTTTGTTTCGTCTGTACATAT
GTAGGGTGGAAAAACTACGAGGTCAATCAGGCGTTGCATTTCTGCGGCAATCGCTTTTGTCGGCGTAAATTGCTCGAGGTATTCTCGCGTAATTGCTTCA
GTAAGTGTTAGTCCATCGAGGCTGACGGCGCGTGATAACGCAACGTATAGCGTTTGACACGGGACAGCACGACGCCGATCCAGCCGTGTAACAACTATTC
CATCGTGGCAAGTTTTGCCTTGAAGCTTTTCGGTTGTGCATGCGAACGCGGGCACAAGTGCAAATTGTGTCACTGTGACGGTGGATTGGGACAAATTCGG
AATATTAGCGAGCCGTACGCTTCCGTGGCGTGGGGGAAGACCAATGACACCTTCCGGAAGCCATCTATCAGTATTGACTGCACCCCATGCAGCCGGATGA
GCATCAAGGTTGGCAACCGTAATAGCTTGTGGATGAAAACATCAGACGCCTCATAGACAATTTCAGGTAGCTCGTCAAGGGGCGGGTGTGTGCCTACCAG
TGTTCCTATCACTCCGTTCGCAATCACATCTGCATCGATCAAGTCGGGATGCTTATGCGTTACCATAACAGGCATTCCGACGAAAAAAAGCAGCTTCATC
GGGATCCGGTCTGTAAGGTTATCATTTACGTTTGCGAGGTGTTCACAAATCAGCTTTGACCGTGTTGATGGAACCGCGATACATTCATATACGGCACATT
GCCGTGTGTCCGCAATCCGGAAAATCATATCGTTGTTGATTGCACAACGCAGCTTGTTGGTGCAAACAACAACCGGTCGATATTTAAATTCGCATTGTCC
CGTTGCTGGTTCTTCCCGTGATTCTGCCGTCTGAACTCTGTTGTTTAACAACTCCAGTTGAGCACCCGAAAGACGCCCCCATCGCAAGTCGTCGAGTATC
TTTGTGTAGATAGAATCAAATCTGGCTCGCATATTTTTTGTAAGAAATACGACGAAGTTGATTGCTGCATAGAGTGCGTAACCAGTATGCCTTTGCCGAC
TTGCGTGAGCTGGAGGGGGTACGAAACCTAGGCAAAGAGTGGCACAACTTGTTAGACAAGATACTAAGGTGGTATCTACACACTAGCTAGGAATCGTACA
AGGTGAGCCTGCGACGGGTGGTAGCTGCAAGAGGTCTCCAATCAGGATTGTATGCTTACCTCCCATGAATTTTTCGGGTGTCGTTGACATCGAGCGCGAT
ACGGCGTCCGTTCCCCCGAGTAAACCTTGATCGATTATCGAAATTTCATCTATAACAACTAGCACCACACGCCTGAATCGAAATTGCATCTCAATCGTTG
GGGATCCATTGGGTTCTGCACCGTTCAGTTTTAAATTGCGAGCACTGTGCATCGTTCGGCCTTTAATGTTGATAGCCGCTACCCCTGTGAAAGCCAATGT
TTCTACACTTCCCGCTCGCCCCCACTTTCTTGCAAACGTGAGCAGTGCATCAACAACAGTTGATTTTCCAGTCCCGCTTCTCCTCCTAAGTAACCAATCA
ATTGATCTTTGATATCGTAAGGCCTCACTTGCGTCTGCGTCGGTAGTAATGGCTCCGACAGTGCTTCAGATATATCTTTTGAATACGCGTATAATAGATG
ACGCGCAGCAACCTCAAACACAACATGCTGCCAAAAATTGAGCTGAAATGCTTCTGATACCATCGCAATTTCTGGAAACGCAGGCAATTTTGTTGGCAAC
CAGCGAGGCCGCCCGTCAGGAACACGAAACAGCACTGGTCCGAAACATTCACGTAGTTTTTCTAATCGCGTTGGAGCCTCTTGAAACTGCGCAACAAAAT
TGTGCGTACCGAGACACTCGTCGTTATCCATGATAGTTGTCGTCACCAGCCTGGAAGCGTACGATGCAATATCAAATTCTGGTTCAATCGAGATAGCGCT
AAACAGATTAGAATAAGACTGGCCTGCCGACTCAATTGCAGTTTCCAAGTTGAATACATTTCGAATAGTCGCTTTTGCATCGTCCAATAACTTCTGAGTG
GAATAATCTGGTGTTACGATTGCATTCGTGTCGATAAGGTCGTCAGGAATGATTTCATCTAGAGTGCCAGCATATTGGCGTCCATTGTCCGCAGCAGTTG
GTATTGAGGACGTAGTTGCAGGAGGCCTTGTTCTGAGTAATTCAGCTTCAGCAGATTCTCCTCCCCGATCATCAGATTTTTCACCGCGATAAAAGTCCTG
TAACTGTGCCTCGAAACGCTGCATGTTGCAGACGCTAGTCTTGTCGCCATGCTGTAGAAATTCACGGTATCCGTCGAGTGGCGACTGATTTTCAGCTAGA
AGAGTGAATTGTCGATGAGGTTTAAATAGTGCCAAAATCGATAGGTAGTAGAAGTTGAGTCGTTCAGGATCCAGGTGGCTCGTAATATCTGGTATTGGTG
TACCGCTTACCACTAGCACCTTCCGTGACTTTAATCGAATAACCGAAGTTTCATCCGGAGGATACCGCCCACTACCGCTTGCATCAGCCGACCTTTTCAT
GGTGAATTCGAATCGCTCTAAAATATCAATAAACGCTGTCAACTCTAGTCTCACGTTCCGCTTCCAGTACTTTTCAAGTAGGCTGTCAGAACAAATACTG
CTATGTCTTTGCGAATTATCACATTCCTGCTGCGATACGCTGATCTCAACTGAGTTCCCTCTTTTCTCCAGCATTTTCCACAGATCCACTCGAATAAAAT
TGTGTGAAAACCAAAACGGCGACTTGTTGAGTATGTATAGCGCTGCCATAGGCGCCGCCACTTCTTGCCCGTTGGTAATTGTGTACAACATAGATCCAAG
CATCTTATAGCCTCGCTCAATCGCTGATGTATCTGGTGGTAAAGAGCTTGTTTTTGATGCGGCCTTCGCGAAGGCTGCCAACGACAACGCAATTTGGTTT
TCAACAGGATTTTGACACTTGAAACAATACTTTGCAACGTAAGCAGCAGTATCTTTGGATCCATTACTCAGCACAAACTGAGCATCATGGTTGCACTTCA
TTGCGGTCATCACCACGGGGTTGTATGCATTTATATACTCGCACCCAATAGGTCGATGAATACGAAGACATTGATGATCGTCAATACTAGTGTGGTCGAT
GTGAACAGTTTCTGGTTTCAGAAATCGGCAAACACTCCCATTAGGCGTTCGAACAGTTTTCTGCGTTAATATCATCAGCACAAACGTGATGAAAAGTCAA
CCCATAGCTCCGTTGGTCATCCGAAAATCGTAGCAATGCACATACCTTGAAACAGGACTTGCAGTGGTTCCAGTAATGGACTTGAAGTTCGCGAACAAGT
AACGACATTACAACGGCGCCGTCCGATTCCGAGCAGTGATGCGGAGGCCGGCATTTTTCAAAGTCTTTCCACTGCAAATTCGTTAAATCACACTGATCGC
CTGCCGCGGCAATCAGAGATGCATCGATGATGTCTTTATCTTTAAAGTTTGCACCACAAGATGCGCAAGTAGCTGTTGTAGGAGGTGTGGTGCCGGGGGA
AGGACGGCGATATGCATCGATCCCAGGAGTTACCGCCGTAAGTGTGCCATTGCTGTGGCAACGTACACATTCCCCCTCATTAACTAAGCACGGCGGTTTG
GAAACTAGAACTGAATCCGCAAGCTGAAGGACTCGAGCTTGAAATGATGCGTCGTTATCTATAGCGTTCCCAAATTCCACAGAAGTCGTAGGAAAACCGT
GTAGCCATACAGCAAAATGGGCATGGAGATCACCAGCTACTTGTGATTCCGCAGAAGCCCCAAATGCTCGTACTACTCCGAAGATACCGCCACCCTTTTT
CGGAGCATTGACCTCCTGATCCCATCCAAGAAGAACTTCGATAACGGTATTGATTACCGTTAAGAAATATCGTGCACATTCCACAGGATATGATGCAGCG
ATTCGCTTTCGTTCAGCGCGATTCGGCATGAGCATGGTATTGGCCTCGTCGATTGCTCTTTTCGAAACCTCGCCTGCTTTAACAGCAATATATATGTTCC
AGCGGAGTCGGGTGATATTGTAAAAAATATCTGGAGGGGTCCAAACCGCTTCAGCATTCCGAAAAGATCATGACGAGCACGCATACGACTAATGTTAGAT
CCGTAGAAAGCAGACTCCGGCACTCGAAGCCCCTTGCGCAAATCAATAACTTTTTGTACTTCGTCCACCGGGGGTATCGGCTTCATTCCCTTCGCTTGAC
ATTCCGACAGGTACTTGAAGTACTCAATCGCTTTAATGACTGTACTTCGTTTGACTTCGGCTGCTTCCAATGCTTGCCGCTTGACATCCAGCCTAATGTA
AAGCGTTCGCCTTGCATTCTCAGTTGCAAGATAGTCGAACGCTAGAAGCATGAAAGCGTAGTGACTCTCAAATCGATGACCGTGGATTTGCAAACACCGT
AGAATCCAGTGTCTTACCGACATATACTTTTCTCGTGATTCTGTTGGACCTCCACACGCGGCTGGGAAAAGTGTAGGAAACATTCGCAGACAGATTGCCC
ACTTTATCAATGACATGTATGCATTTGACTTCCGCACGACAACGTCGATGGATTCAGCAGGAGTTGGCGACATTAAAACACTAGAAGCCCCAATCCATGT
TTCCTCTATGGCAGGATCAATGCCTTCTTCTAATGTTGATCCAAACGCTGAGTAGGTGCTCTGATCTCGAAGATTCTCTACGAAAGAAGAGGACGCGCTG
GATTCGCCCGGTGCTGACGTATGATCAACAATAACACTCGAAGACGCCATATTATCACCTCCACGGCGAATGTGACCTTCTTCACGCGCATCAACTGCAT
CCGAAACACCCGGTCTTCGCGTATTTATGACGGCAATTCTTGTTGCACCACGCATGTGAACCCTGGAAACAGCTAGTGCCAATGCGCCTTGGTGCTTTTT
GTATTCACGGTTGTGAAGATACAGAAAGTGGAGATATCTGCGGCAAAGCGGTAAATTAAGCCGATAGCGTTTTTTGCACGCTACTACCTGGTCATTAGTC
ATTTGGCCAACCATTGTTACGCGCACTCGGCAACTCAAATCTCTTGGCAACATTTCCACCACGGGACCTTCAGTGTTTCGGACAACGTAATGATGTGATT
TGATCGTGCGGCATGGCCCTCCTGTCACGACAGACATTGATACGCACGGCAAAACCAGCGCTACCGCTTGCTCATCTGTTCGTGTAAGAGCCTTGAAGCG
ACTAGGCAAATGGCCAATATAGTTCCCGTTGGCAATTGCGTTCACAGGTAAGCTAGGCGACGACCCTCCCGTAATGGATTCATTGCATGAGGGGCAAACT
TGACCCCACACCCGCCGCTAGACTTATAAATTGCTATCGCACAGCAAAGAATAAGATGCTTATTCACTAATTTTTCATCATTGTTAAAATCTTACCCGGG
GGTAGAGCAACAACCCCTTCAATCGCTCATCGACGTCTGAAGCGCTGTACTGACCAATAATTACGTCTGGGACGTTCTTTGGTGTCGTCAAACAAACCTT
CATACGCTGCAACATGGAACAGAATAGTAAACAAGGCTTTGTAAGCAAATGTTATACCAAAAATTATACTTCACTGGGAGAAGCAAACAAACCTGAATAA
ATTCTTCCGTCAATTCCATCCGAATTATCTCGGTTTGTCCATAGCTGAGCTCACAAATACAACAGGCCTGCGCCTCCTCCGATGCTGAGACCATTGCTTT
TATTGCTTCCGATTTAATGATATTTAGTCGTTCCGGACTTGGCACTATGAATTCACAGTTTTTGTCGATTGCTTCCAATTCAGAATCACTGTAAACGTGA
GGAAGGCACGTATCGACGACTCCATCATCACAGGCTTCTTCCGATACCGACACATTGTCATTACGCCTGCTAGGCCTGCTAGGCCAATTATGCCGATCAC
TCATAGTTTCACTGACCGCCGCAACATCCGGCAACGTAGCTGGTGTCGATGTACGATCTGATTGCATCCACAACGAATTCAAACTTGGAGGCTCTGTTCT
GGTTCCACTATACCATTCACGAACGGCAGTGCTATCAAAAAACGAGAAATTGACAGGACTACCATTATTTTCTTGCCGAGTATCACTTTGATTTTCGGAC
AGATGCTGTCGCTGACGAGACCGTCGAATGGTATCACGTTCTTGTGCTAGAACGCTGTACATTGCGCTGTTTCGTATCGAATCATTTGCTTCATGTTGTC
GTCTTCGCTTTGTCGGCATTTTGAAAACCGGGCAATGGCTGACGTCACTTCAGCTGTAAACGGTGCGATGGTGTGATGTTCGGCATTGAAGTGCACAATC
AAGTGCAGCGCTTCGAATACACATTCGTACCGGTAGGACAATCCAAAGCGCGTTAAAATAATTTGGAGCCAAATAGAAGAGCTTGGCACGCCCCCATTGC
CCATTGTAGCAGCCATGGACCAAGATCAAATACAATGTAACGCCCTTTATCGGCGTGCAGCGCAGCATGCCAATCTCCCGTCGCGGTCAAAGTATCTGCA
TCACCACACCTTGTAGCGTGCAACCACCAAGCATGCCGTCTCCTCTTGTCGCACGGCAGCTTCAACAATGCTCCCATCGCCTCATAATAAATCGCACCTT
GACTTTCCGCGACTTCGCACCCTATTGTACAGACAGTGTAAGATAATTCTGACATCGTTCCCACATGACGCATATTCGATAATCCCAGCAACTGCCCCTT
CACAACTTACAGCACTCTTGCCCATCGTAGCAGCCATGGAGCAAGATCGAATGCAACCGAAGCCGCCATGGGCCAAGATCGAATGCAATGTAACGCCCTT
CATCGGCGTGCAGTGCAGCGTGCCAATCTTTCTTCGTGACCAAAATATCTGCATCTTTCTTCATGACCAAAGTATCTGCATCACTACACCAAACCAGTGG
TTGTAGCGAGCCACCGCCAACCCAGCACGCATCGGGAGCACCGAGCGGAGCTTACCCCGTCTTTCGGTGGTCCACTTGCTCCATGCCAGGACATTCAAAT
CCATGTATACCACTACGTGAGCCGCAGACCAAGCACGCCGCCTCCTCTTGTCGCACCGCGGCTTCAACGATGTTCCCACCGTTTAGTTTTAGGGGTTCCA
CAACGACTAACGACCATAAATCACACCGCGATCCCACGTGACTTCGCATTCTGTTCTACAGGCAGCGTAAAATAATTCTGACACCGTTCCCACATGACGC
ATGTTCAATAATTCAAGCAACCGCCCATTCATCACCTACAGCACCCTTGCTACTGAATCAGGGGGCAGAAAACTTTTGATGTTGCCAATTCACGCACACC
GTGTAGGACTGACTCACATGGGCACTGGGACATGGGCACTGGGATTGTTGTACAAAACAATTCAGATAATTCATACAAGCTAAATGGCGCAGCATTTAGA
AAACATGTCAAACAGAGACCATTTCCTTCACAGGCCGTTTGCGCCAC