Description :
From Genome Similarity Track
Location :
contig_36:201805- 203814
Sequence
2009 bases(100 bases per row)
TTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGATAAAACCTGTCGACACGACCGCGTCACTCCGGACGCTTCGAGACCT
TCTCGAATCCGATCGAATCAGGCCCTGCTGATTCGGTTCACATTTCCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTCGGGGTGATCCGAGACAGCC
GCATTCCGCGCTGTCTTTGGTGAAGGGCCGCATGCATCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGA
AGTGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGAC
GATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCATACGGGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCC
AATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAA
GAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCAGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTTTCACTGGGGGTAGCGATCTT
CATTGCAGCGTGTCCGATGTCGACACGCTCGACCGCATCACCAGCAGGACTCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGTTAGACCGTGACGATACC
CAGTATCGCCACGACGGCTTCTCGCCGTGTGCACATGTGCTGTGCACTCGCGAGCGTAGTGACGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGAT
CCACGGTGCTGCTGGGAACCAGCAGTCGTCGCACTCGAGAGGTTCATTGGTTCGGGACCTCCCGACGGCCTTACCACCGGTCGTGGCATCAGTCGCGGGA
CGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCGAGCGCAATTGCATCCTCGAGAGTTTGGATACTCTCGGAAGAAATAGGTCT
TCACAGGCCCATCTCTAAGGCCCTTCATGAACATGACGACCTTTGTCGCCTCATCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCCCTTTG
GGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTTGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCC
ACCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGGTCCGTGAGTCGGCGTCCGTCCGCCCAACTCCTTGCTCGTCCGCCAAGACATGACATGGCGAACG
CAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTCCCCCCTCTCTTCCAACGTAGCT
ACTTACGTGGAGTTTCAATGACTCCCCGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGA
GCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGCCTCCCACTCTGGTTCCGACAGG
TGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGTGTTCGTATT
CCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCAC
GTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCGCAAGTTACTTAAACCTAGATAAAGGGACCGAACGATAGCTTTGGTGC
CAAATGAGA