Description :
From Genome Similarity Track
Location :
Scaffold_1554:2018- 4344
Sequence
2326 bases(100 bases per row)
CTCCCTCCTAATCCACCCTTCCCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCTCCTCCTCCTGGCCCACACCCTT
CCTGTGGGCCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGGTCCCCTCCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGCT
ACGGTTCGTACGATCCCTCAAGAAATCATTGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACC
AGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATGTCGGTGATCTTCTCGACTTCGAACTCGTCGGCTTCGAGATCCACATTCC
AACTATCTTCCGGTAGGAGGACTTCGTCGAAATCCACCCGGTCGGATTCATCCACCGAAAGACGGGTCTGCGGCCGATCCGGATATTCTTTGACCAACTT
CAGCTTGGATACGTGTACTACAGGGAACAAGCGATATTCGGTACCTGCCGTTTCCAGCTTTACCGCATGTTCTCCTATCTTTTCGCTCACCCGGAACGGT
CCATGCCATAGATGGGCTAATTTGCGGGCGTACCCTTCTGTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTTGATGCGGACGGGCGT
CTTCGTTGTGTCGATCCGCTCGATCCTGTATCTCACTCTGCAGCCGTTTTCACTTGGGATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTATCGCCATC
GCCTTGGATCTCGGTTTCTCTTCTTGGTGCTACACACTGGAATGGCTGCTTCTAGGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTATC
ACCCCGGATCCTGTCTTGGCGGTATTCATCGCGAAGGTGAGTCGTTCTGCGTACTCATCCCAGTCCCTCTGATCCAAATCCTGGACATACATCTTGAGTG
CCCTCGTGATTGTCTGCACCATGCGTTCGGCCGATCCGTTAGCTTATGGACGAAATGCCATGGTTTCCCGCTGTCTCTGCCCCAGGATCCGGTTGAAAGC
TCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGCCTAATCATCTCACTAGCTCAAATTCTTCGGAAAACGCACTCCTCGTATGATTCGGCAATG
GTTTGTGCAGCTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAGATCCACCCAGATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCA
ACGAGGGGATGTGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGCGACCCCCCTTCGATCGTGGGCCTGCCCTTGCCTGTCTC
ACAATCCACACATTCACCGACATACCGTTGCACGCTCTTGAATAGCCCCCTCCAGTGGAAACATTCTCGGATCCGTTGGTAGGTCCGACCAATTCCCTGA
TGTCCACCTTCTAAACTAGCGTGATAGTGATGTAGGACATCCTGCTGTAAGGTCTCCGGCATCACCAGTCTCATCAATCCATCTCGATCCTCGTTGACTC
TCTCGTAGGAGGACAATAGAAGAGCAAGTCATTCAGATCCACTGCATAATCCGTAGCGATGATACTGTAGAATTTGGTATCCTCCCGACTCAGGTCTCGT
ACATCCCCCATCAGATATTTCTTTAGTCCCAAGATCCACGCTTCTTCGTTCTGTGCTTTGAGGATCCGCTCAATGCGGATTCCCCTCACAAATGTTTCAT
CGAGAATTTGGGGGTTGGATCCAATCTTCCCTCTGGATCTAGTGACAGCCGTTACCTAGACTGTCATTTTTTCCGGATCCAACCACCACCACTTCGTCTA
GTCGGTTTAACGTGACGAGATCCTGACGCTCGGCCTCTCTCTCCACCTCGACACTACATTGATTCCGTAAAGCGGCACTGGCCCAACTATCTGCACTGGC
ATTCCAATCTTGCTTGACATGTACCAGCTCGTGATCCATCCAACCGCGCAGGTGGACCATCACCTTCTGCCGTAACAGTGTTAGGGCAGGGGCCTTGCAG
TCAATCTCACCTCGCACCTGTCTAATCACCAAAATTGAATCCCCACAAATCACCAGCCTTTTCGGATCTTGTCCCTTTAGTAGATCCAAACCCAGCAGTA
GCCCGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCGTATAAGTGGATCTGGCCCGTACTACTTCCCATCCAGGTAGTCTCCACAGTATCGACACGTG
TACGCCCCGCCTCCGCGTCGTATGCG