Description :
From Genome Similarity Track
Location :
contig_111:2018- 4062
Transcript NameFunction/comments
g13179.t1OWZ00175.1 Integrase, catalytic core protein, partial [Phytophthora megakarya

Sequence
2044 bases(100 bases per row)
CGTCGGCTCCCAGAGCCGACGCGTCTTCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACCAATTGTGTGTCGACATTACCTGTCGACACTACCGC
GTCGCCCGGACGCTTCGAGACCCTCTCGAATCGGATTGAACCAGGCCCTGCTGATTCGGTTCACATCTTCTCCAACGACTCTCGCAGTCGTTGGCGTTCG
CTTGGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTAGTGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCT
GTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGA
ACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGAC
ACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCT
CCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGAC
TCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTT
TTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCAGC
GGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACC
GGTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTG
GATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTT
CGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTGCGGGG
GCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCC
GCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGT
TCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCT
GTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAG
TCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTG
TCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCT
TAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAA
ACCTAGATAAATGAACCGAACGAAAGCTTTGGTGGTAAATGAGA