Description :
From Genome Similarity Track
Location :
Scaffold_1690:2017- 3610
Sequence
1593 bases(100 bases per row)
CTAAGTTCCTTATCCAAAGGACACTTACAGCCCAAGACCAGGGCTCAAAGTTAACACCTTAACTTTTATGCTTCAAAACCAGAAGTGTTTTATTTACTAT
TATTGCGGCCAAGCCGCCTAGGGGGTAAATGTATCTGTTTAACTATCTAGCATAGTTAAACCTAACCCAAATGCATAACGTGTGGCTTTCGGCCAACGTA
CTGAGAGACCTTGTTAACTCTCCGAGTACTTCGTACCCCTGTGTGTTCCACACCATGTAACCCCGTTACATTGGTAGTATGCCATTCATTATCTGTCGAG
ACATTTTACGGCAGAGGCTTATACATTTTTGTTCTTGCCTTTCATTTTCACCATGAAGATATTTTCCAGTTCCTCATTTTTATTTGACTTATCTTTTCAA
ATTTAAAGCCTCCCAGTTTCTTGAGGATGTTTAACTCAGAGTCAGCACAGTTTTTTTTTTTTTACTTGCTTGAATTGGGCAGTAGGCATCATTTGTGTTT
GCATTGTCAACTTGACGTTTTCGTGTGTGTAGTGTGTTTTCACTCTTTATTCCTTTTTCTTTAAGGATTGTCGGTAGTGGCAGCGGCTCAGTGGCTTGCC
TGGACTTTGATTTCTCTTTCTTATCTTTCTTTGTAAACAAATACTACTAGTAGTATGTAGCAACGTCGATGGCAGTGGCTCGTTGGCTTGCCTACTTTGG
ATTCTCTTCTTTCATTTTTGAATCAAAACTTTTGATTGTCGGATCATACAATAAATGACACTTTGCCTGAATATGCAGAGGCACGGTGGCTTGCTTTCTT
CGCACTACAATGGTAGTATACTGCCATTATTGTTTGTGGTAACAGTGGAGATAGTAATTTGATAATTCCAACATTATCTTGGGCGATATTACAGCCCGCA
TACTCTGCTGATAGCAGGCTCGTTACGCAGTGCGTATTATAGTGGGCGATATTACAGCCCGTATGCTCCGCTTGTTGCGGGTCAATGCGGGGGCGACATT
TCTGCCCATGTACCCCGCTTATAGCGGGCTCAATATACAATGCTTATCATTGTGGGCGCATTTACAACCCAAATGCGCCGCTTATAGCGGGATCATAACG
CAGTGCGTATGGTTTGAAGTCTAGGGAGATTTTCTTCTAGCTCAATATCGCGGGGCAGACGTCCTGCTTAACGCGCGCAGCCCGTTAGCTGGCATAGAGG
GCAACATGGCCTTGAGGTGCCGATGGCACATGGTAGACTCCCGTGCGTCCTCTTGTCGGCGTCGAGTTCATGCCCTGTTAAGCCAGGTGACGCTCTGCGT
TTGAGCCGCCCTTATTGGTAGGAAGGGTCGGGCTTATAACTTGTTGGCTTGCCGCGTCCAGCTCGCCTCCTATCCGTCATCTGTCCTCTGGCGAAACGTT
GGGGTCTTAACCTGTTGAGCCAGGTGGCGCTTTGCGTTTGAGCGTTGGGCTAATAACCTGTTGGAGGGATGATTTGCGCAGAGCTGTTAGGGCAGCACAG
AATGGAGTGAGGACAAAAGTAGAGTGGTCTAGGCGGCCATAGTGGAGAGGAAGTCTTGAGTGTAGGAGGAGAAGACGCTTGTGTCGGACTTGG