Description :
From Genome Similarity Track
Location :
Scaffold_842:2017- 3550
Transcript NameFunction/comments
Phyag_g8321conserved hypothetical protein
Phyag_g8322transposase

Sequence
1533 bases(100 bases per row)
CTACACCATTTCCCAACCAAGTTAGCACTTTTACCAAGGTAAGTGAACATACAGTTTTTTTTGTTCAAAACAACTCGAGTAGAAAAAGTGATTTTTCACA
AAGTGAAAATTGTATTAGTCGAGCTCTCAATCAAGTGACCATGGCTACATTCTAGTTGCGTCTCTACTTTCTCAGCCGCATATCCTCGCCTCTCCCCGCC
GCAAACGAAGCCTTAAGGCAATAGCGTTCCATGCGCCACACCAGACGACGAGTAATCGCCGGTTTGGCCACCTCTACAGCCTCTTCCATGAGAGCCTGGC
GATGCGCGCAGAAAGTGTCGTACTCGCTTCTGACTAAGAACTGCTCCTTGCGCTCCGCAATGAAGCGGCGCATCTTCGCATTCAACACGCTCCAGCAGCC
CTCTATAGAGTTCAATATGGGGCTATATGGGGCGAGGGGCAGCACGACCAGCTTGCTACCATTCATAATTCCGTCCGCCGCCAGCATCTCCCTAGCCAGT
GACTCCACCTGACTGTGAGCTGGCGCATTGTCAGTCACAATGACTACCTTGTTAGTCGGCGCCAGCTCACAGTACTCCGCTGTTCCTAGCGACGCCGTGA
AAAGGTCCGCAACAAAGCGAGCgttctcctgcttcgtcacGGAACCGGCGTGCGTGCGCATGAGTACGATGCCCGTACCCGACGATACGCCACCTTGCAC
GTGCAGGTTGGAACCCTACGACGAGGTGAGCGCCACTGTGGCGCGCTCGCCAACGCGCGAATAACCCTCGTTGCGGGAGAggtacatgttgaagttggtc
tCGTCCTGAAAGACGATCATGTCTCCCCGCGACATGTGCTTCTCCGATTCCTCCATAAACTCcttcctcttgttcttgttctccgTCTTGTTCATGGTGA
TCTTCTCAATGCGCAGCTCTTTAAGGCTGTAAACCATGCCCTGCAGGGCACGGTGGACGGAGGATGTACTCACAGACACGCCTAAATCGCTGCGCAGCCT
GTCACGCATCTGCTAGCGCGCGTGGCGACAGTCCTCGTAGAGATATTCCTCCAGCTTGCCCATGACCTCGACGGTCATCTTGACACGCGCCCCACGCACG
CCGCCGTGCGTCTTGGGTTCACCGTCCGCGTCAAGGACGTCACGGCGGGCAGTGTTGTAGGGGATGTCGTTGTGGGCTGCGACCTCACGCCAATTCTCAC
CGTTCTTGTAAGCACGTACGGTGCGGGCCTTGGCTGCCGCACGCTCGTGCTAGCGTTGCTTGCTGGTCGGCTTGGTGGGGGAGGGCATGTCTGTCAGGAA
GAAGGCTGAATTGGAAGTGAGAGGGACCGGATACAatggctggtgctggaggctgccGTTTTGGCGCCAATACGGTTGGCTGTGTTCACTTGGTTGGGAA
CTCGATTGCGCGAAATTTCACTTTGTAGGAAATGCATTTTTTCTATCAAAAAaccttgttgaagtttttgcACAAAATTAGTTCCTTTCACTTGCTTTGG
TAAAAGTGTTAAGTTGGTTGGGAAATGGTGTAG