Description :
From Genome Similarity Track
Location :
Scaffold_39:201683- 204444
Transcript NameFunction/comments
g8322.t1hypothetical protein

Sequence
2761 bases(100 bases per row)
TCGGAGGCCTCTGCTTGCTCATGCGTTTGCCTTCAACGCTGCAATTGCGCCTAGAATCTCTGTTGTCAGCTGGTGGTTGGCCATCCACATCGATTCACTG
TCTCGCTTGTGGCGCTTTGACACTGCGTCCGAGTTGGGCGCCTTCAGTGGCAGAGCTGGAAAACGCTCAAGCGCCTCGTTCTTGACGTAGTCCCAAACCG
CACCTTCGCCGTTGACCTGCTGGAGTGCAAACAAGACCACGACAGGACCTCGGTACCACCACCCAGGGTGCCGCGGCTTCTGCGTATCCAGCATGACAAA
GAACTCAGCACCGAGCTCCTCGTAAGCAGATATGATAACCGACTCGAACGCGTTCTTCGCCGTGAGCTGACGGTTGCTGCGCTTGTTGCAAGCGAGCAGG
TTCGTCTTGCGTGACATGGGAGCCCAGAAGTTGCGCTCCCACACAGCACGAGCGTGGTTGCGCCAAAACTTACGAAATCTTCGTGAAAGTTCAGGGTGCT
TGGGCTCATCAAATGGTGCTGGCAAGTTGGAATACACCGCTTCCCAGGGGATCTGCGCCTCAAAAGGCCCCATTCTCCGAGTTAACTCCAGCTGACTGCG
GCAAATGTCATCACTCATTGCCGGCTTACCTCTTCTGTGAGACTTCTCTTTAGCTCGCGCGGTTCTATCAACCTTACGCTTTCGTCCTCTATTGGCCTTG
GGGGCCTCCAGCGATTCAGCCAGAGAAGCTTCAACCGGTTCTGCAGTTGTAGCAACACCAGAACCCTTTGATTCATCACTTGCAGCTCTTTCTTGCAGCT
TCCTGCCACGTTTTGGAGTTGACACAGCGGCGACTTCAGTTTCACTGTCGGGTGCATTCACAGGGATCCGCTTGCGTCGCCTCTTGGTGACAATCTCAGG
CTCTTCCACAGGAGCATCGTCAGGACCCTCCACAGCTGCAGCATCTTCCTCCAACACCGAAGCCGAGTCATCTTCAGGCTCTCTAGGAGCTACCACATCT
TGCCGTTGCGCTGAATCATCAGCAACAACCGCTGTAGTCTCTCTCGTCGCCGAAACACGACGAAGTCTCTTCTTTTGAGGCATCTGCACCTCGTCAGCTC
GTGCTACAGCACGAGTGACCGCTCTTGGCGACGCTGCCGTCCTCCCTCTCCTCTTCTCCCCCTTCTGCTCGACAGCCACGTCCGTCGCCACTTGCTGCTC
TGGAGGCGGTGCCTGATACACAGGAGATACCAGTTGGGGCAGCTCGAACGGAATCACACTGATCACTTGACATCCTCGCTGCACGAAGTCCATGAGCGCC
GTATCTCGCTGGTACACGAACTGCAGGAACATGTGCTTGAGCAACGCCATGTTCCTCGTGGCCGTGCGGTACTGCAGGTAGAGGAAGACGCAGCCGCGGG
AGTCGAGGGTCCATTTCGGCTTGGACAGCAGGAATTTCGCTTGCTGCCGTCTCTGGGCGCTGGTTCGAAGCACCGGGAAGACGGTGATGATGGTACAGCC
TTGCTGCATCATTGGCACCAAGGTGTTCTCCTGCTCATTGAGGAAATCGGCGAAGATGCGACGCAGCATCCACAAGTTCTGCGACTTGAGACGCAGCTCC
AGGTAGACCGCGAAGTCCTGCAGCATTGCGTGGTCTCGAGGCACCGACGGGGGAGGAGCTCGGCCACGACTCACATACCCATCAAACGTCACTACAGAGC
GCGCACGCGTTGTGTGTCCCGAGGAATCGACGGTCGTCGCCATCGTGTCGATCTCGTGGATAGTGATGAATGACGAACAGGAGTCTGAGCCAACGGCGTT
TGACTAACCGAAATGCTATGTGGGACTAGGACTGACGCAGCAGTTGACCCGATTCTTGCTGTCCGAACCAGCCGAGCCACGTCTGGAAGGTTTTTGCTGT
CAGTTTGGTCTGATGGAACTCTTTGGCCGTAGCGTATTTGCCTTCAGAGCCGAGGATTGCGACTGCTCTGGAGCGAGCCCATGATGCAGCAGAGTTGGCA
ATGCGTTGCTGGGCTCGACGACAGCGCAGTCGCAGCTTGGCACGATGGGTGGCGACTCGTCGCCACTGACGAAAAGCTCGAGTTTTAAGGCAGCGAGTGG
CCAAGTGGACAGTAGCAGTGAGCTGACTCGGACCTCCACTGTACAGACAGCGATAGAGGTAAAAGCGGGTGTACGCCTGCAAGACGCTCGCCTTCATAGC
TTGATGGGCCAGCAGAGCCGCTCGACCGAGTACCTTCGGACTAATCGGTGGGTTCTTTGGACTCCGAAGCAGCTTCACCGAAGACTGGCGAGCCACACGG
AGCTTGATGATTGGCTTTCTTGCTCGCAGTTGAACGCGACAACACCCCGCCTCTCCTTGGACTGTTGCTGGTGTCTTAACCCCGTGCACTTGTCCGTCCA
GCAGCCCCGACGTCAGCTTTTCGAGCGCAATCGACTCGCGCTGATACTCTCGTCTCGTCGACGTACTCAGTAGCAAAACGTCGCTATTAATCACTCGCAA
TTGCCCATCGAAGTCTGAGCAAAAGGAGGCGATCAACGCAGTGTATCTACGAGCACAGGCGTCCGATCCAACACGCGCGACTGGTTCCAGTTGATCCTGA
GCTCCCCCGAGGTCGTTCGAGCTCGAAATTTCACGCCGTCGATTCGCGTTTGAGCCAGCAATAGTCCCTCTTTCACTCCGCTTTGCAACACTTTTCCTTT
GCAAGAAAATCTTCTTGGCGCGGGCTAGCGCCGGGAACACCGCGATGTCCGCCATGATCAC