Description :
From Genome Similarity Track
Location :
Scaffold_30:201681- 203984
Sequence
2303 bases(100 bases per row)
TCTCGATGCCACCGGAAAAAGTGACAAAAGCACTAGAGCACCTTCATATCATGGGCGCCAGAACGAAAACAACACGAACCGAATTACAGAAGCTTCTGGG
CAGTCTTCGTCACGTGGTTACATGCATCAGGCCGGCAGCACCCATTTTCCAACGGGTTGCAGCTCTAGCACGCAGCGCACCACGGTTCGGATATGTAGTT
GTCTCCGAGGACACAAAAGATGATCTCCGGTGGTTCGAGATCATTATTCGAATTGGAAGATTGAATGCAATTCCTCTGTCTCGTTTCACGTGTCGCCACG
CTCCTGACTACCACATCCAAATGAACGCCAGTGACCAAGGGCTATGCGCCTTGTTTCCGGCACGAAGAGAGTTCCTGCAAGTAAAATTTACGGTGGAAGA
AACGCGGCTCATTAATTTCTGCAATGAGACCGGCGATAGCACATTCTGCATCAACGTACGGGAGTTGATGAGTGCGGGTTTTGCGTCTCTGGTATGGGGG
CCTGTGTGGAAGAGTCCCGGTGTTAAAAGCGATTCCCATGTAAAATTTTGGATTGATAACACTTCGGCTGTGGCTTGGAGCAACCGCAAGTCACGTCGAA
ATAGTATCGCTCAAATGCTGCTTCGCATTCTCTCCATATGCGAAGTCCAGTACGGGTTCTATACATCAGCCTCTCACATAGCCGGTGTGGACAATATCAT
GGCAGGCGCATGCAGCAGGGCGTGGCGGTCGCCATCTTTGGCCATTATGTTTGCTAACTTGAGCTCTGATTGGAAACAGGTTCAGATCCCGGACGACTTG
CGCGATCTCTCAAATCTTTGGGGAGCAAGGGCTTTAGCCCAATCGTCCAGAAAATACTATGCACGAGCGTGGGAGCAGTGGTCTGCTTGGTGCAGCATGA
TGCGGCGTAGTCCGTGACTGACGTCTGCTGATATCAACAAGAATTCAGAGCAGCTTGGCGCATTTGCTGTGTACCTTTGGAAGTACGGCATGAACCGGCG
TCAACGCGGCAATATTTACTCAACAATTTGCACGAAGCTGTGCGCTGTGCGGTGGTTCCACCGCAATACGGCTGGTTATGACCCGGGCGTGAATGCAAGC
CATGTCATCCAACTGCGCGGCATTCGCCGTTTTACCGATCCAGTAGTCAAGCAGCAGCCCTTGACCGCGCGCCTTCTCCGATCGATCTTTGGACTTCTTA
ATCTGACACGGCCGCGCGATCAACTCTTGTGGGGTGGTCTCCTCCTTGGATACTTCTTCCTGCTCCGACGATCGGAGTATCTTTTTATTGATAGCGGAAT
CCACAACTACGTCCTGTGACTTTCAGGAATTCAATTGCTCGATGACAAAGAGCAGATCACAGGGCCAAAGAAAGCCAAAATTGCGGTGATCAGCCTGAAG
GGAGCTAAAACCAATCAATTCGGGCGAGAGGAATTGAGGTTTCATTACAAGTCGGGAGACAAAGTGATATGTCCTGTCAGAGCAGCACGTTGGGTCCACA
AAGCCGCTCGAGCTTTCGGCACACGAGCAGATGATCTCGCGCTGGCAACACAAGAAGGTGATATAACGTCAGCAGAGATCGCAAAAATTGTCAAGCAAGC
AGCCCAGAGTGCCGGTCTGGATCCCGAGCGGTTCTCAACTCACTCAGTCCGCATCTGAGGCGCTACATCGTTGCTCAATTCCGGTGCCGATCGACTAGTC
ATCAAGCTGCTTGGTCGGTGGTTGTCGAACGCGTTTGAGGAGTATCTAGTCCTGTCCGCGAAAGGTTCCACAAATATTATTTACTCACTCAAACCCTACT
GTTCTACAAACCCTATTTTCACAAAAATTGCAATTACCACACCTTATCAACACCACTTTTAACACTTATTTTTTCTTCTTCTTTTACTAACTAACATTAC
ACTACATATGTCACCCTTTCACATATACTTCACCTTTCTACCAACTCTATACCACTTCAATTCCTACTGTTTTATATCGTTACACACTTTAAATACAATA
CCCCTACATACACTTTCCCCAACTATCACATCCCCACCTATTCCACTTTCATAACACTCCACATCAATTCCAATTTTACTCTCTATAACCTTCACATACA
CCTCACCCCATTCTTCTTCCTCATTCACCTACTATAATATATATTATATCTCTACCCATTCTACTTCTGCATACTCTTCATATACACATACAAACCATTT
TCACACACTCTATATTTACTCTTACTTATTTCCTTCCATCCAACCTTAACCAACTTCTTCACCTTAAATTATATCTTTATCTTCTTCCAATTCATCCTAC
CTT