Description :
From Genome Similarity Track
Location :
Scaffold_239:20166- 21411
Transcript NameFunction/comments
Phyta_totarag6038hypothetical protein

Sequence
1245 bases(100 bases per row)
GAACGGGACACACCGACACCAGCCTGGTCGTTCTTGCCCCCGCGAAAGTTGACCTACACCCGGCCGAACACGATCCCTGGTGTTGCACCAGCTACCCTCT
TggtcgaagaagcagatgtCCGACCGACCAATTGCGAACTGGTATTGCTGGCTGCCCGTGCAGAAGTTCTCACTGCACCTCAGTAAAAAGAAGAAACCCA
TGACCGCAGCCCCCCATAAGACACGATCATGGGCTGAGTTGGAGTCGAGTCGCGTGTGCAGGATCCGAAGAATTGACAATATGATTGGTTGCTTGGGCGA
GGGGAAGGTTGAGTCGATGGGTGGCTCTGATTGCCATGGTGTGatgagggggggggggctgatATTGTAGCCGAACTCCCAACGATGATACCACGTGACT
GCGCTGATCTTGCATTGGATGGTCTGTAGCGATTTTCCTCTGGAGGATGTGGAGCCACTGCCGTACCGGTAGCAGTATACTGCGTAGAGCACAAGCTGCC
GGGACGCGACGGTCGAGTCTTTCGGGAGCCAGGGACTGTATTCTATGTCCGCgcaccaacgccaccacTGCTTCAACACTTGGTACCGTTCGTGCGACGA
TGCGGCCAAAGCGTTGGACTGCAAACTCCTTGTAGATTATCCTCCAGTGCTCGGGCACCTGCACCTGGTgccacaaacacaacaatTCAGACCACAGATG
TGAGTAAGGCGCGGACCACGCTCTTGGACATGCGTCTGACATGCGGTTGGTCGACCCTGGGAGGTGTCTGGTAGATAGTCCGATGCTGAATACTGCTTCA
GCAAGATCGATGAGTCGGCTGATTTCTTGGCCGAAGATGTTCTTGGAGTGAAGCTGGTTGGTCCATGAAACTGCTGAGGTATTGTCACTCCAACAAATAA
GGTGAGGAAAGCTGAAGTCTTCTTTCCAGCAAGGTCCCCAGCACCAGGCTGCCAGGGCCATGCAGAAATGCTCGCGCACGTTGATGGAAAATCCAGATGA
CTCGGAAGACTTGACGAAGCGAATCTCCTCGGTATCGATACGAAGCTGGATGAACTCGTTccgtgctggatgaagtacGGCAAGACCAGAGTCGGGGTAT
TCCATGTAGAGGTTGATGGCAGGAACAAGGAGCGACCCGAAGAAGCGGAGTGGTAGATTTTCGAGATGTCTATCCGAGAGAATGTAACGGATCTACTGCA
AATCTCGCCGCGAGGAAGCACTTAAGCCACAGATGAAAGGGACGA