Description :
From Genome Similarity Track
Location :
Scaffold_81:201641- 204389
Transcript NameFunction/comments
g14545.t1ETP25916.1 hypothetical protein F441_01272 [Phytophthora parasitica CJ01A1
g14546.t1hypothetical protein

Sequence
2748 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGT
AACACCTTTCTACCAATGAGAGTAATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACC
CCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTCCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTA
AGTAATTTACTCCTACGCTTCCTCCTACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCGCTTTGTAGTCC
GTCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGAGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGC
AACGCATGTTGCGCGTGCAGACTGCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGA
TGTTGCGAACGCTATCACCGACGGAGCAACACCGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATC
GGCCACACCGCGCGTGGAGTCATTAAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGTC
ATTGCGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCA
CAGATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACAAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCCT
CGATCTGCAACAGGGCAAGCATGACGGGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAG
GTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTCCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGC
AAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGCCTGCTGCCACGACCGGTGGTAAGGCCGTCGGGAGGTCCCGAACCAATGGA
CCTCTCGAGTGCGACAGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTTTTTCCGCTGCGGAAACATCGGTCACTATGCCCGCGAGTGC
ACAGCACCTGTGCACGCAGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATCAAAAACCTAAAGGGACCAGCAGGCGCGGGGCGCCCTGC
TGGTGATGCGATCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCG
AACCTTGTCATCCTGAAAGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGAGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTT
CAAGGCTTGACTTCGAGGAGGTGGAAACACCTCGAAGTCTATTGGAAGTGAGACTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGT
ACGCTTCTCTTACCAAGAGAAGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCGCGG
CATGATCCGGTAATCGACTGGACGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGCGCGATGGCCCTGTCGGCGCAGCACGTGCAC
CGCGTGGTGCATGCGGCCCTCCACTAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGGAAAAG
ATGTGAACCGAATCAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGACTCGAAGCGTCCGGAGCGACGCGGTAGTGTCGACAGCTAATGTCGACACACAA
TTGGTCGAAAGACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCG
CACCGAAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCTGCGGGTAGAACCCGC
CGGCGAATACAAGGAACAACTGTCCACGGCCGGGCCTGGACAAGAAGAAACTCGCGGAGTCGGGCTCCGCACGAGAAGTGAACGGCGTAAGCGATCAAAG
CTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACACTGAGTGTCTTGACGC
GTACAAGTATTGGTCTCCAATACAAGAAGATGAGGCTGGATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTT
CACTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTC