Description :
From Genome Similarity Track
Location :
scaffold_471:20161- 21966
Transcript NameFunction/comments
g8634.t1 conserved hypothetical protein
g8635.t1 conserved hypothetical protein
g8636.t1 E3 ubiquitin ligase , putative

Sequence
1805 bases(100 bases per row)
AGGGACAGCCCATATAGAGAAGCCGGCGACGAGGTCAGCAGCGCTCGTGTCCTCCACCATGTTTCTCCAAATTGTATCGACACTTTGCACTTCAAATTGT
GACACAAATCAGAGATGGGTAGTTGTAATTGGCTGAAAAGAAGGGATATTCAAGATGAGGCCTCTATTTGGGTCTTCACAGTAGCGAGCTGCTTGGTGAA
GGCGGCCTCGCCAGCGCCTAGGGCGTTCTCCTCGGCCGAAGCCAGCTCCGGCATCTCCTTCAAGCAAGCCAGAATGGCTGTTGCAGAAGTCTCTAATTCG
CTCACAGCCTCAGACAACTCGTCAGTTCCGATGGGAGGGTACAACGCCGCGCCGAAGTCCACGATCGCGTCCTGCGCTGCCGTGTAGCTGATGTCCAGCT
GGGCTGTCCACTTCAAGAACGCGTCTTGGTCGTTCGTGATCGTCAACTTCTTGATGGTCAACACACCGCGTTTCATTATTGCAGCGCACATCGACAGCAG
CTTCAATCCGCTCTGGAACAGCGTACGCTCCTCCTCCGTCAAGTTGGAGTCGAAGCCGAACTCGTCGTCCTGCTCCACCTCGTCCAGTGCTGCACCTTGA
CTGTCACCTTCCTCCTGCTCAGAGAGGAACTCATTCAGCTCGTCGATTGTCGAATTCAGCATCGTAATACACTGTAGCATATCAGGAAATCATCAGCAAA
GTTGTAGATACAGCAAATAGCCCTAAGCGTTCGTACCTGCAGCATGCTGCGCTTTGATGCCACGCAGTTGGACTTCGACACGCGCGAAGTAGAATACTCC
CATACACGACCAGTTAGTTGTGGAACCTTGGCCAAATCACCCTTTTCGAAGGTTTTTGCCAGGTCGTGCACGCTTTTGATCAGACGGCTACAACGCATAA
GCATCAAACCAGTGTCAGTTCCGAAACCAGCTTACTACGCTATTGAAATTGATAATGTACATTGCATCACTGATAATTTCCGTCGCGAGTGACGGACCGG
CACCGCAGAATAGCGCAACGTTGGTGGCGGCCAGAAGTTGCTCGCAGGGCTTGTCCAGCGCCTCACAGATGCTGGCTCCTTCCTCCTTGCTGGGCGTCTT
GCTATACACAAGCGAAAACTTGGTCACCGTGTGTCCGATGACTCCAGTTGCCTACGATAACCAATAACGATCAGCACGTGGAGCAATGTATTAGAAACCT
ATAGAGCTCTCGCGACGACCTACCGCAACGAAAACCTCCCGCGCGACGTCAAAGTCCGTATGTTGCAGCCAGAATGTGGGCCGGAAGCTGTGCTGCTTCT
GGTTCCTGTCCTGCAGCTCCTCCAACTGCTCCAGGTACTTCACCAGTTGCGCGTCAAAGGCCGTCAAGAAGCTCGTCATGTTTCTAGCTTCGATGAATTT
GGTCTCTTCCAGCCAAGCACAAAGTGGTACAATCATTCCGTCTCGAATGGTGTCCACCACATAGCTTGTCAAAAACCGGTAATACTTGCAGCAATTTACG
CGGGAACCAGAGCTGCAGTCCACATTGCGCTGCCTCAGTAACCCAAGGGCAGCCTCGGGTCTTCATTCGTCTTCCCCCTTATAAGATTTTCTTACATAAC
CTTTATTTGCAAGGTGACGCTACTACTAAAAGGGTTAAAGTCATGCAGATGATGGGCCTTGAAGCCGAAGACATGCAGGACGAATGGGAATGGCCGGAGG
ACTGCAAGCCGCAGCGGGAGATGGAGAACCACCTGCGCTGTCAGATCTGCGGCGACTTCTTCCACGGCCCAGTGTTGTTGCCCTGCTCGCACACATTCTG
CTCGA