Description :
From Genome Similarity Track
Location :
Scaffold_5:2015157- 2018079
Transcript NameFunction/comments
Physo_287904P-type ATPase (P-ATPase) Superfamily

Sequence
2922 bases(100 bases per row)
CAACGCGCCGACCGAGTTCTGCTCCAACGTGGTGATCACGTCCAAGTACACGACGTGGAACTTCCTGCCGCTCTTCATGCTCGAGAGCTTCCGCAAGCTG
GCCAACGCCTACTTCCTGCTCGTGTCCATCCTGCAGTGCATCCGCAGCATCAGTAACACCAACGGCCTGCCCTCCAACCTGCCCGTGCTCGTGTTCATCC
TGGCCGTGGACGGCGTGCTGGCCATCATCGAGGACCGCCGGCGCCACCTGGCCGACAAGGAGGCCAACTCGGCCCAGTGCCACGTGCTCAAGGAGACGTT
CACCGGCACCAGCGACGCGCTCAACCGCGCCGGCGGCGTGGACGACCCGGACATCGCGCTCATGCACTGGGCCGCGCTCACCGTCGGCTCCGTGGTCAAG
CTGCACAACCGAGAGACGGCCCCCGCCGACCTGCTCATCCTGGCCGTGGCCGAGCCCAACCCCAGCGAACCGGCCGGCATCTGCTACGTGGAGACCAAGA
GTCTGGACGGCGAGACCAACCTCAAGCTGCGTCACGCCTGCGACGCCACGTTGCACGTGCGCACTGCGGCGCAGGTGGCGGCACTCGACGGCCAGCTGCG
CTGTGAAAACCCCAACAAGGCCATCGGCCGCTTCGACGGCACGCTGTCCGTCACAGAAGGCTCGAAAGCCGCCGACTCGCACCCGCAGCCCATCGCTATC
AAGAACGTCCTGCTGCGTGGCTGCCAACTGCGCAACACGGACTGGATCTACGGACTCGTGGTGAACACGGGCCCGGACACGAAGATCATGCAGAGCGCCA
CGGCCACGCGGCCCAAGTGGAGCTCCATCAACGAGACGGTGAACAAGATGATCATCTGGCTGTTCCTGCTGCTCTGTTTCCTGTGCATCATCGCCACGAC
CGTGCAGGTGATCTGGCTCAACAGCAACATCGAGGAGAGCTGGTACCTGGACTGGTCGCCCAGCATGACGAGCCAGTGGTTCATCGGTTTCGGCTACTAC
TTCCTGCTCATGTACCAGATGATCCCCGTGTCGCTGTACGTGACCATTTCCATGGTCATGTTCATCCAGGCCATTTTCATGACGTGGGACCTCGACATGT
ACTACGAGGAAGCGGATGTGCGCATGATCGTGCGTTCCATGGGACTGAATGAGGAACTGGGCCAGATTTCGTATGTGTTTAGCGACAAGACGGGTACGCT
CACGTGCAACGTCATGGAATTCCGTAAGTGCTCCATCAACGGCGTGTCCTATGGCACGGGCACGACGGAGATTGGCCGCGCTGCGCTGCGCCGTAAGGGT
GTGATAGTGCCAGCAGAGACGGAGCCGGACCCGGCCTCACGCCGCGCCAAGATCCCCTACGTCAACTTTGAGGACCCGCGGTTGTTTAACATTCTGGAAC
GGCCTATCAATGACGACACGCCGAACCGTGAGGCCGAGTTTTTCCTGCACCTGAGTCTGTGCCAGACTGTGATCCCGGAGACGGTGGAGGGCAGCTCGGA
GGTGCGTTTCTCGGCCTCTTCACCCGATGAGCAGGCGCTGGTGTCGGGAGCCAAGTTCATGGGCTTCAGTTTCGAGTCTCGCGGTCTGGGTGTTGCTCGT
GTCCGCGTAAAGCGTCCGGAGCTTGTTCGCCGCTACGCTAACGGTGCGACAGGCTCCAACGTACTGCTCGAGTTCAAGATTCTGGATGTGTTGGAGTTCA
CGAGCGACCGTAAGCGCATGTCGGTCGTGGTGCAGTACCCCAACGGTGAGTACTGGGTGCTCACTAAGGGCGCTGACAACATCATTTACCCCATGCTGGC
GAAGGACAAGAGCGACCCCGAAATGATGAAGGACACGATGCGTCATTTGGAGACGTTCGGCGACGATGGTTTGCGTACGCTCACAATCGCCCAGCGGCGT
GTGGACGAGAAGGAGTACCTCAACTGGAGCGCGCGCTTTAAGGAGGCCAATTCGTCGCTGGAAGAGATTGACAAGCGCAAGAACGGACTGCCCAATGAGA
TCGACAAGCTGATGACGGAAATCGAGCGTGATCTGGAGCTGCTGGGTGCGACGGCTATTGAGGACAAACTACAGAATAATGTGCCCAGCTGCATTGCCAA
CCTGATGCGTGCTGGCATGCGCGTCTGGATGCTCACCGGTGACAAGCAGGAGACTGCCATCAACATTTCCTACGCCTGCCAGCTTATGGACAATGACATG
CAGCAGTTTATCTTCAACTGCGATCTGTATCCCACAAAGGATGCTATCTATTCGCACTTGACGGATGCGAACGCGCAGGTACAGCGGGGCAGTGGTCGCC
ACGCTGTTGTGATCGACGGCGAATGTTTGGAGTTGACACTTGCAGATGAGCGATGCCAGAGCGAATTCCTGTCGCTGGCCATGGCCTGTGAAGCCGTAGT
GTGTTGCCGTGTGTCTCCTAGTCAGAAGGCTGAAATGGTGACGTTGGTTCGCACTGCTAACAAGAAGGTGCGGACGTTGGCGATTGGAGACGGTGCAAAC
GATGTGGCTATGATCCAGCGCGCACACGTTGGTGTCGGTATCTCGGGACAGGAAGGCATGCAGGCTGTGAACTCGAGTGACTACGCTATCGGCCAGTTCT
ACTTCCTGGAGAAGCTGCTGCTGCACCACGGCCGCTTGAATTACAAGCGCATGTCGATTCTCGCGGGCTACATGTTCTACAAGAATATCGTAATGGTGCT
GGCGCAGTACTTCTATATGTTCTGCACGGGATCTTCAGGCCAGAAGTTCTACGGTGAGTTGGGTTTCCAGCTGTACAACATTTGCTACACTTCGCTGCCC
ATCATTGTGCTTGGAGTTTTCGACTACGATGTGCCTTTCGAAGTCAGCAAGCACTTCCCCGAACTGTACCTGGTTGGCCCGCGCATGGAGTTGTTCAACA
ACTACACCTTCTTCAAGTGGAT