Description :
From Genome Similarity Track
Location :
Scaffold_72:201450- 210259
Transcript NameFunction/comments
Hyaar_Emoy2808012chromodomain protein, putative
Hyaar_Emoy2808013chromodomain protein, putative
Hyaar_Emoy2808014hypothetical protein

Sequence
8809 bases(100 bases per row)
AGTTGCCGACCGATATTGAACGGATTGTGGACCGGAAGCTGATCAAGCAGCGCGTGCACTACTACGTGGTGTGGAAGGGCTTTGGAGAGGAGAACAACAC
GTGGTACAGACAGCAACAAGTCCCACGTAATACTTGTCCCACGTGGAGTAATAAAGGACCAATTTTGACTTGTCTACGCTTGTGGTTCGTGTGACAATAT
TCTTGTAGGGAGAGTCGTCTCGATCTCATCGCTGATGGCTACACGGACGCCATCAAGAGCTACGAAGAACGTACGCAAGCAATTCAATTCTCTTTTTTAA
TTTCTCTCGCTCTCAGTGGCAAAGAAAGATACGATTTACGTCACATGATCTTGAACTGATCCTTTTTATGTTTTTATTGTTTTATCTTTATTTTTATTAT
AATTTGTCAGAGCGAAAGAATCAGGCAGAGACTTTGACGCCTCGTGGCCGGAGTCCTGGCCGCCCGTCGTCCAAAAGCCCGCGGACAAAGAGTCGGAGTC
CTGGACGGGGCGTAGGTCGCCCACGAACGCGACGCAGTCGTTCTCGCAGTGTCTCAGTGAGCAGGAAATTGCCAATGAATAGCAAGGACGACGCTGAGCA
AAGCAGCAGTTCGTTTTCGAGCACGACGACGCGGCAACGGAAGAAAAGCCCAAGCGATAACGTAGAAAATGTTGCAGCAACGGAGACACCTGGACGTCGA
TCGGCTCGAAAAAAACAACAGACGACTACGGAGACGAGCGAGTTTGTGTCTCGACTGGAGGTGCATAGTGGGGATCCCATGATGCTTGATGAGGAGGACG
ACTCGGTTCTGTTGCGGTCAACTATTGCGGCGCTGACTCCAGGGATGCACAGCATAGCTCCGTCAACCCGACTGGGGTCGGAAAGGGACTTGCACGAGAA
GTCAGTGGTGCTGTCGTACGAGGCGGACGAAGAGTCGGAGATGTTGTTCAAGAAGCACTTAGTACCCGAAAGGAAAGAAGCCGACAACTCGAACGCCAGC
CCATCATCGTCTAATGCTGTTCACGAAGATGCCAGCTCGACTCGAGATGGAATGGTTGCCAAGATTACGACAGGTGGCGGCTATCTCATGTCATTCTTCA
GTGCAGCGACCGTGATAGGCTCTCTCGTGGCAAGCCATATGCTGCCTCGTGAGGACGAAGAGGATTCCAATCTGTGGCGAAGGTGGCTTCCGTTCCTCAC
GCCCGTCGTGTCACTGCTGCTTTTCTTCAACCTGAAGGATGCGCACGCTTCAGCGAAGTGGGTGGCCACTAGTCTGGCGTGGCGTGCTGCTGCAGAGCTG
CTCCTATTGATCGGGACTACACCGCGCGAGTTTGAGATGATGGTGGCTGGCTCGGTCTTCGTTGCTAATGTGTCATTGCTAATTGCTTTCGTGTCCGTTC
TTCACAACGATGAGCATGTGCAGTCCAAGGCTACACGTGCACTGCTCGGAGTTGGATCCCTGGCGCTCTTCCTATCCGACAGGTAAGTGTCGAGTTGGGA
GTCCACTTGCTGTGCAGTTGTTGGTGCGCTCTAATTTTACCTATCTCTTGTTGTTGTCAGCTGGGTGATTTCCACTAAGAATACTGAAGTGGAATCGCGG
GTGACTCTCATGTCCATTGCTGTCGTAAGTACTGCTCGTGGTGCCGAGTAATGAATTGTGTGACTGATGCTCATCTTCTGTTTTGGATGCCCAGCTCACA
ATTGCACTGTCGCCAATGCCATCGGCATCCATGGAGGATGATGAGTAGGATAGGCGATCAGGCTCAAGCACTTGACGCTGTTATTAGTTCTCGCTGACTT
CATTCGGAGGCAGTACTGTCACTGCTAAATGAGTAATAATGATCTTGCTGTTGCCCTAGCTGGCTGCTTTGGACCGCTTAGTAGTCGAGGATTTTAGAAA
AAATCAAGAGATGGCACTACTGCAGCGCCAAATGCAGCGTCTTCATTAGTAGCTGCTGGGTCTGGTCACTCATAGCGGAGTCAACATCATCCTCGCAGCG
CACCAGCTCCTCAATAACCTCGATTGTAAGTGCTGACGCAGGACGCGCTCCTACTGGATGTTCCGGTCGCGATGCGTACTCCTTCATTGCCTTGTACATA
AGGGTCTGACGCATCAGTACCTCTGTATTCTCCTCATTCACACCTGCCGCCGACTCAGCCGCGATATCGTCCCATAATTTGCCATCATCGACAATGCAGG
ATCGCCACACATCGGCACGCATCTCCTTGTACTTCTCGGTCAGCGGGTCAGTTGCTTGTGCATCCAACGCCTCCAGCGCCATCAAGAAAAGGTTGGTTCT
GGTGCACAAAACAAGAATTGCATTAGCGTGAGAGCGGCACCTTCTGCCACGCACAACACGACAGCGGACTATACCTCATGGGGTCATCCTTTTCAACCGA
AAAGGCGGAGGCCAAGCACGTATCGACTAGCTCTTCAGGTGAAAGCGGCTGTGAATTAATGGGTAACTCTAGCGGTAGCTGCAGCAACAGCTCCTGAAGC
TTTCCACGCACAAGCTGTGAAATATAGACGTAACGACTCTGTCAATAGCATTTTTGGCAAAATGTTAAACCAGTCAACGTACCTCGCGATCAATTTCCTG
TACACTGTCAGGATGAGATAGACTGGGCGAAGCAAAGGCGGCGATTTTAGCAATGCTAGCCATCGTCTTGCGCTTTGGCAACGATTGCTGCTCTCGCTTT
GCCTCCTGAAGTGCAAGTGTCACTACCTGGTCATATCGCTCGATTGAGATTGCAGTCAACCAGCAGTACTTCTTCAGGTGGTCGCGTTCGTTCATAAATT
TGTGCAACAGCGGCGCAAAGAGCTGTGAGTGGGCCAGCAAGTATGCCAACATGGTCCGAGAAGACGCATCCGCCTTTTGGTCGTTTTGGGTCCAGGGGTT
CCGAACTTCGCCGTTACACCAGCAGAAGATAAAGTCGTCGAAGCCCTTATGCTTCTTGCAGTATGACTCCAACCTCTTCGATGCTGGGCTCTTTGGGAGT
TTGCCAAGCACGCAATCCAGCTTATTTAGGTTCTCCGAGTCTTCAATCAATACCAGATAAACCATGCCTTCAAAATAACAGTACTTTTCGCAAAGCTCAA
CACACTGGTGGAACAAGTCTGCACGCTTACGGGTGATCACACCATCCGTACCAAAGTCGACTGCAAATTCGCTGTCTTGGAAAGGTGTCTGGGTTGCAAA
GTAAACAAGAGGGTTTAAAGTCACGCGCTTCGTGTATGCTTCCTCCGCGCGCAGATCGTCTGCATCCCCGCGCAAGGAAAGAGGAATCAAACTACCGTAA
TCGTCCAGCAAAACGGTTCCTAGTCTCCGGATCTGATCTATGATCACGAAAATCTCGTCGTACTGCCAGCGAATTTGTCTCTCACACGATCCTGACTGCG
AGTATCCCACAAGGGTAGACAGACGAGAGATTTGATTAACCACAACTTTTCGCACCTCGTGCGCGAGTGTCCAACTTCCCGTCGGTGCAAATCGTAAAGC
TGAACCTTGCACAGGTGTACAGAGCATACTTAGCATAGCGCAACCGCTTTCCAGCAGGCCGCATAGGTATGCTGGATCGCTCTCACTAACTGCCGTCGAC
AGTGACTGTACCTCGTCGTTTAAACGCTCGAATAGCTCCGTGATCTTACTCACTTCGCTGTAAAATACATCAAAGGAATTGTAGCCAGCCAGGCGAAGCT
GCTCCGTCCGATACCCACGTTCTACAACAGTTTTCTCGATTGCGTGTAAAATAAACTTCCCAGTCAGACGGCATAGAGTCTCCGATGCAACTCCATCGTC
GGAAGAATTCGGAGACAGAATCGAAGCCTGTAGCTTGCACAGAGCAATTGCAGCTTGAAGCTTCTCCTCATTCTTCGCCAACTCACACTGAAGCTCGGTG
GAGTTCTCAATAAACTCCCAGACGGACACACAGCGGCGTTGCAAAAACTCCAATAATGCCATGTGACGATTCTTCTTTTCTTCCAATTGGTAGCGTACCA
GCTTCGGAGTAACAGAGAGAGTATCAGACTCCTTCTCTTGCACACCGGTCTTGGTGGTCGGTGCGCCCTTTTCCCATCGCAAGCCTGATGACGACTTGGC
ATCCAAGATTTGAAGATCTACAATAACCGCAGCCTGAGCCGCATGCCTCACATCCCTTACGCTCACACGCAGCGCCACTGCAGAGTTCGGTGCTTCGTGA
AAGTGCGTCAGAATCAAGCGGACATAGTCTTCAACGGTCAAATTCGCCTCCCCGAAACGGGATAACTCATTCGTCTCATAGCTTGCTTCGCGTCTTCGAC
GCGCCCTTGCTGCAGATGCCTCGGACGGGAGTGGAGATGGGAAAAGTTCCAATTTTTGCATATCCGAGGCGGTAGCCATGCATACTGATCCATTCAATGA
CTTCAACCCTTCTTCGATGAGCAAGAACAAAACTGATCCCCTCACAGCATTGTTGTCAAACAAGCTCTGGTCTGCGCGAGCTCCAAATGCCAGAGCCAGT
CTTCCTTGAGTACCTTGAAGCGGGAACGCCGTCGACCGTACAGTGGGTTGCCCAATGCGAGGTAAAAGGAGCGCACAAAACTCGACAGGCTCCATCTGTG
TCCACACGAGGTACAGAGCGCCACGTGTGACGGAAAAGCTTTCGACTGCAATAAAATGGTCGACGGCCTGCCCATCGAAAGCAGGCTCAAAGTCCAGCAT
GTGCACCCATTGCGGCGTTGGCAAAGAGCCACCATTCACTGCCTCGAGTGAGAACTGCACCAGCGCGTACTTGACCGTCGCATTTGTTCCCGATCGTGAC
GATGAGCAGATAAAAGCCACCAATAGACCGACACACGCGTCGTGCACGTATGGCACTGAAATGACGTGCACTTTTGCCAAATGTGCTTCAGGGAAGTCGT
TGCTGAAATAACTTGTTGCTACGCGCCCAGCATTAAAATGCCATTGAGAAACACATGAGCAGTCAAGGACATCTTCAATGTTAAAAGAGCGTCGTTCCAA
CATCCCGTCCTGGAACAGCACGAGCATATCCGACGTATCACCCAATTCATCTCCACCACTGTCAATCGACGCTGCGTCTCCAAAAGACGATGGAAGAACC
CTCAAGCACGTAATCGGCTGGTTTACATCCAGCTCTTCCTTGTCCGCTCCAGCTCCTGACCCAGTCGACGAAAAGAAAAACTGCGACACTGACTTGGTGA
TCCCTGCCAACAAGCCTGCACTCTGCTTCTCAAAAGCTCGCACACGAATGCGTCGGTCTTCCACCGCGACTTCCCACACATTGCCCTGATTGCTCCAGCA
AATCAGTCCATTAACGCCTCGTTCATGTCTCCCGTCGTGCTCCGCTGCTACGATCGCAGCATGGTCGTGCGTATACACGAGTTCATTGATGTCCAACGGT
ATCTGTACACTCAATGGTATACTCTCATACGGCAGCTCAATATCTTCCCAAAAGAGCACCAAGCCGCTCTTAGCGACGACTAAAAGACTGAGACTTTGAC
TGTCGAGTGCAAACAGAAAAGGGTACACCACGTCGTCCGACTCAAGTTCACCCGGAAGTTGTAGTGCAATCACTTTGCTCCACTCTTGTTGCCACAGCAG
CACTTTATTGCGTAAGAAAAACACAAAGAAAGGGACCCATTGCCGGCCACTGCGATGACGCGACGACGGCACTGACGCCCGACAGCAGCGCACTTGGCGT
CGCTGGTACAGAGGCGTCTGTAGGTGCCACTCCTTCTGCACTTGGTTCAGTACTGAAGGCGGTACTCGACCGCCTTCGACGATCGTACAGCGACGCGTAT
CCACTAGCAATGACGTCGCGTCTTCGACCGCGTCGCTGACGCCCCCTGACCGCCGCGCGTACAGAGCGTCCCAGTGCTCGAGGCGCTGACGCTTGAGAGC
GCTCGAGACGTCCGTAGCCAGCAGTCCCGCGTCGCCCAAGCGCTTAGAAGGCCCCTCAACGAACGTGCGCGCGCGGAACATGACGACACGAAAAAAATGA
GTGGGTTTAGTATTGCCGGGGTCAAAAGAGTATAGTAGGAGTGCTACTATACATATGTATACACAACGAGAACAAGAAAGCGGATATTCCACATGGCTAC
ACTTTTGGTCAGAGCAATAGGTTGTGACGATTAACGTGTGTTGTGTGCTGCTTCACTGCGAATAAATACGACCCGGGTGCGTGGCGGTTGCAGCCAGGCA
GTCAGTCGTCACTCGAGTTGATACCAACTCATAGCGTGGGTCCTACCACCTTTATAAACAAGCAGATGAGAGCTCTGCAGAGGATCCTGGCGACCCCATG
GTCAGAAACCAAGCGTCGCGCGCTTGTTGCGATACGCGAGTTCTGCGTCTGCTGCTTCCGGCGACGTTGCGTTCGCTGGCTGGTCCGCAGTACTGCCGTT
GGATGAGGAGACGCTGCCTGGTGCTTTTCTACCGTCGTTGAAGCGTTTCCGAAAGTAAGCATGTGCAAGTCCCAGCACCTTTACCCATTTGAGCATCTCT
TCCTGGTTCTTCGCAACCAGTCGCGTCTGCTGGGTAGGTGAGCAGATCATGAACTCGTGAGGCTTACCCACATCCTTGCCATGCAGGATCTCCAACGACT
TGTGCTTCAGTGGAATAGCACCACGAGGCTCGCGGTCGCCCTCGCGCTTGTAGTAACGAAGGTACCCATCTGGCTCAATATTGCACCACCGCTCACGAAC
GCCACGCAGCGACATGTTGCCAAATGTGCCCTTTTCATTGGAGTGAGTTGGGTGCTTGCGTAGGATGCCACTCATCGCTGGCAATAAACCAATCTGATTC
GCTGAGTCTTGCGTCAACGAGTTTACACTGCTGCTGCTCCCACGGCTGTGGTCAGGATCAAATCGTTCCGAACCTCGTTGCACGGTGGCCGATTGTCGGC
TGACACCCTGCACAATCTGAACACCGATCATGGACACTCTGCCCCCAAATGAGCCTCGGATACCACCGACGGATACACGAGCACCAACGGTATTCCTCCG
GGCAGCTTCTTGCTGTGGTGGCGGGCCGGTAATAGATGATCGTGGTGGTGACTCCGTCGCATTGGTCGACACATTTAGAGTCCCATTTGTCAACGCCTGG
AATTGATCTTGCACCACTTTCATCTCGTCTTTCAGTTGCAACCGCTGTTTACTGAGCTCGCTTTTTCGTGCTTCGTCATTGTCACCTGCAGCCTTCGCGA
GCTCGATAACAATTTCATGCAGCTTCGTTTGAAGCTTGCCTAGCTTAGTCTGTAAGCGCGTCGACTCCGACAAGCGTCTCTGTGGAGCTTCATCAATGTC
AATCGTGTCAATCGAAGAATCTGCGGACGGCAAGACAACATTTTTACCCTGATCGATGTCAAAGAAAACCTGCAGCTCGTTCTGCATTCGCAGCATCTCA
TCCAGTGCCGCCTTCAAATCATCTTTCAAATCTGCTCGTCGAAGTGACAGGTTGTCGGCCTGTTGCTGATCTCCACTGCTAGTGGCGCTCGCTATTCCAG
ACACGGTTTCTCGCAAATTCTTCCGCAGCAGTGCAATCTTGTTCTCCAAAAATATCAATTGCGGCGGACGTTCCCCGCTAATGAAGGCATCCTCGCGCTT
GACCGCTGCTGCAGCCACATCCATTTGATTCCGAAACTGGTATATCTCTGATTCCACAAATTTAGTTCGCTCTGCCTCCATTTCGATCTCTTCCTCAAGA
TGATCACATTGTGCTTTAACTTTGATAAGAAGCTGTTCACGCGCATCCGCAGCGCGAGTATCAATTGAGCCCCTATGCACCATCGAGCCCAAGAACGCCG
GTGAGAAAAACTTAATCTCCTGCTCGCCGTTTGGGTCCACACTAAGATCCCCATACTGGTCCAGCTCATTTTGCAAGCTATCGAGAGTCTGCTCTGTTTC
AGCGCGTACTGCCCGCAATGCGTTGTTCTCGGCGATAAGTTCGGCGACGTCCTTCTCGAGTTCCATTGATCGCTGAACCAGTTCTGCCGTTCTCAACACT
TCGGGGGATTCGATTTCGCCCGCTGCTTGCTTGTCCAACTTTTCAATCATCTCCGTAAGCAAGCATTCCTCTTGCATCAAGTTCTCACGCTCCTTCCCTA
GCGATTCTTGACGCTGCTGGACACTTTCGACTTGCGTCTCCATAATCTCGCACTTCTTTTCCATCTCCAGGCGTTTCATACACATGTGATGGTCCGTTGC
TGACCATACTTGTTTGTGCAGCTCGCTACACACCAATACCTGAAAATACTCTTTGCGGAGTGAGTTCTGCATCACTCGAGCCGCACGAGCTTCTTTAACC
TCTTCTGTCTCCTCAAGTAGAGCTTCTTCCTCGACTCGGCCCACAATGCCTTTAGTGATGTCAGCAAACTTAATGCGGACGGGGCGTACCAATCGAGCAA
GCAGCTCCAGTACCTCCGAGTATGTGTAACCGGTCAGTGGAATCCCATTCATCATCGTAACACGCATGTTCACAGCAAGACGCTTTTCAGGCTTCATGCT
CCAGTTATAAATCTCAGCGGGACTTGCCATTCCATTTGGCAGTTTGTAAATTTCTGCGATGTGGACCTGGAGGTCAGTAAACACTGTGCCAGGAACACCA
GCAATTTGTTTCAGATTGAGTCCCAGTCGTCCGTGTCCGAAGGTAACTTCAATTTCGTGTACCCAATTGTAAATGACACCCGTTTTCATGGGAGGGCGCA
ACCACTGCGTGTGGCCGTAGGGCGATACATAGTACGTTTTACCGTCATTGCTTTTGCTCTGACGTGTGGACCAGCCCTTCGGCAAGGCCAGTATCTCTCC
AGTCTCCAA