Description :
From Genome Similarity Track
Location :
scaffold_7:201447- 203586
Sequence
2139 bases(100 bases per row)
GTTTTCTCCTTTGTGCAAGATGTCCGGCAGCGACGATCCTGACCATTCCATCACAGCAATGCTCGAGTCGTGATAGACGTTTGTCCGGGTCAATATTGAA
CACTTTGTCGTGCGTTTGCTAAAGAACTTAGAAGCGCAAAGATCCTGAATCGAATCGTTCTAGCGCTCTCGCGAGCATATTCGTAGCTGCAAATCACGTC
AGGAACATCATGCTTAAGAGACTCTCGAGGTTTTCAGTGTCAGATTCAATTGGATAGATAAACTGCTGTACTCTATGAAAGCGTTGACGGCTCAAGTCTC
TTCCCCTGGTCGATCCTCGTGAGTAAGTACTAACTGGGCGATCCAACAACGCTTTTCCCCAGGATGAATCAGAAGGGATGGGGCTGATTGCAAAAACGAT
CTGTGGATTTGAAAGTGGAAAAGCGCTCATCGTGCTTAGGTGAAGTTTTTTATGCGGAACTATGAGACCGGTGAAATAGCCTCGAAGATCAAATGAAGAA
GCATATGCCGAAGATTGATTTGCTCTTTGATAGTCTAGTCCATCATCCGAAAAATTGACTCTTGGTTTGTCCAGAGAATTAAGAAGGTTCATGCAAGACT
TGAGTGAACTCAGCAGCTCGTGATGCGTAACCCTCAAAAATTCACTGAGTCAAACTTAACTCTGTGACGCCAATTAGGTTCGACTGTGGAGACCTTTCCA
GCTTATGACCTGACACTCTAGAATGGAATAATGGCTAATGTATCGTGTAAGTGATCTGTGGAGATATGCGTAGATTTGTTCAACGCAAACTTTGCGCGTT
GGAGAAACTCATTCCACTCTTCGAAAGACATCGCGTGGCATTGCAACACGTCTTCCAGGACGCGATTCACTCGTTTCCATCTGACTGCCTGTTCTGAGCG
TGCTACTGCTGACGTGAATGGGCTCGTATCCAAATTATCACGCAGAGCACGCCAAAGAAACTTTGGACGTGAACAAAGGGACACAACTTCCAAAGGTAGA
CTATATAGGCGGAGCTTTACGTCTAAAAAGATGTCCCAGTCATTTTTGTTGAGATCTTGTACGAGACCACACCAACTTGATAAATAGGTCCACAAACATT
AGATTTTCACTCGTGCAATGTTTGTCAGTTGAGGGTTCAGATACTAAATCCGACACTTGTAACAGTCGAGTGACGCGCTTGTCTTGATACCAATCATTTG
GACTCGGCTTGCTTGATGTCGAACTTTTCTTGCATCGCACGTTTGATGAATGCGTCGAATGTCGTAAGGTACTTTCAGAGTAATTAATTCTGGATCGGCC
CAGCCTCAAACTCGCCATGAATCTTACAGTTTGCGTTATAACTTCAATCGACCTGTCAACGATGCTCGATCTCAAGCAGCGTCGCACAGTGCGAAGAAGT
GTGGATTGTTATGACCTGAACATAGCTTCAAAAACTTGTCACGGGCAATAACCTCACTTTGTGATGGCTCAAGCGCCCACAATAGCTCGATCTTAACGCC
TTTAAAGCTAGGAATGCTGTCAAGATCGCTTAACGCCTACCATAAACCCAGTCCTTTGGACGACCTGCAAGATTAGATATTGCGAACAACACATGCTGTC
GAAGTTGTTTTGCAGTGACTGCCGCATCCAACCCGACAAACCGTCATGAATGAGGCTAAATCTCTCCAACACGATACAAAGACACATTCAGCTTCCGAGG
CATCGCTCTGTCAGAAGAGACAGGCATTGCAATCTGCTTCCGAGATTTCATTATCTTAAGATGAATTTATCTGACGAGCTGCGTTCTTCTGACTATTCAA
GGAAAGCAACTGCAGTATGCTGACCGCAGCAGCTTCTTCAGTGACTCCTCGTAtctattcaaaattgattaCTCATCTGAAGACAGTTTAGGAAACATCT
CATATGTTAGCATCTCGGTTTGCGGTACTGATTAACCGAGTAGTACTCCAACTCTCTCTTTGTCACTCGAATAAAGATAAGTGTATGACTTGGACAGAAA
CGTGCGACGTGCTTAATAATCTCATCGTCGAACCGGGAGTGAGTGTCGCTGGAAATACCGCTCGAAATGCTGCCAGGTGCAAGAGGGCGCTGCTCTCAAC
TGTCCCTGATACACTCCTCAtaagcttgtgcgacgagga