Description :
From Genome Similarity Track
Location :
Scaffold_43:20140- 22769
Sequence
2629 bases(100 bases per row)
GCTGCTGTGGTCAGCCTGCTTCGATCGGCATCTCCTGAAGACCAAAAGAGCGCTGCGGTCAGTTTCATGCACCACGAGATTGTTGAATCTCGAAAGCAGG
TCGCAACCCCTGTTTCGTCCTTCAAGACGGTGCCTCTGAAGCTGAACGTGTCTCCGTATCGCGGCGGAGAGAACGAGCCTCTTTCGAGATGGTTCGTTGA
GTTGGATGCAGCAGTGTCTGCAAGACAACTCCGCGACCCCTCGCAGCAAGTGTTGTTCGCAATGTCCAACCTTGCGGGTCGTGCGAAGAGCTGGGCTTAT
GGGAAGCGTTTGGCCGATCCAAACTGCTTCTATAGCTACGACAATTTCAAGGCAGAACTCAAGATGGCGTTTGAACCACCGCAGAGTGAGTTCCGTGCAC
GCGCCGAGTTTCTCAAGCTTCGCCAAGGTCGTTTCGATCTACACTCATATGCTCAGCGAGCTCGTTATCTGGCCTCGAGCATTGTGGACGAGCCGATTGA
CGTCCCAACGCAAGTTGTGACGTTCATGACGGGTCTGAACGACGGTCCAATCCGGAAGCAATTGTTCCGTGAGTACCCAAAGACCCTTGAAGAAGCCATC
AGCCGTGCGATGCAAGAAGAGTTTAGCATCAAACAAGCCAAGTTCCAAGGTTTTCCGTCAAGACCACCAAGGCAATCGAACGTCGTTCATGATGGTCCAG
AGCCAATGGACATCTCGTACATTTCCACTCCTGGAAATGAACGTCCTCACAACGATGGAAAGTGCTTCCGTTGTGGAAAGTCGGGCCACTTCGCTCGAAA
TTGCAAAGTGTCTTTGCCTGATCGGCAAACGGCACAGGGCTCGCGCTCGAACAACTACGGCCGTAGTAATGGTCGTCGGTTCGATCGTTCCCAAAGGTAA
AAAAACGGGAACGACCAGTAGGGGCGGGGCCTCCTACTGGGCTCGAGAAGAGGACTGTGGATGTTGTGGGAACACAGGACTCTGGCCCCAATGTGCATGA
TGCACATGCAGTTTCCACGAGTGAGAGCAGTGTCAGTCAAACGTCAAGTTTGATCGTTCTCAAAGTTCATGTAGACGGTATTGCAACGCCTCTACGTGCT
TTAGTTGACACTGGTGCGTCGGACAACTTTGTTCGAAATGAAGTGATCACCAGGCACAACATCTCTGTGCCTGTTGCGAATGAAGAGAAGATGATGATTG
TTCGGTTGGCCAACGGGTCAACTGTGAAGATGCCAAAGCGAGTTGTTCGCTTGGCAATGAAGTATGAAGATTTCCGAGGTGAAGACGAGTTCATTTTACT
CGACCTCGGATGACAAGTTTGATATCATCCTGGGCATGCCATGGTTGAAGCGTTACCAACCTAGCATTGACTGGATGAAGATGAAGATCTCCGTTGACAA
GCCGTGCATCGCCGACTTGAGCTGCATGACAACGGATGAAGTGGTATGGGTTTACACATCTGTGGAAGAAGTCCCAGATGGCCCTTGTGATATTGCGGTG
TGCGATGGCCCCCCATGCTCACAAGCGGCACCCATTTTGAAGAAGACGAACGGAGGTGGAGCAGTCAGGCGCCATAAAAAGACTGTCTCCTTTGCCATCG
ACGACAAAGTTGCGTGCGATGGTAGTGTGAAGAACGACGAGAAAAGAGGCAGAGACCCATCCCAAGACAAGAAGAAGAAGACCAGCAAGAAGAGTGTTCC
GCCAAGAATTTTGAGTGCCCCTGATCAAGGTACAAGTCAAGATGACGAAGGAAGTGTCCAAGCACAAGACATTTCAAGCGAGTTTGTGAACGTTCTGGTC
TCGAACGAAGATGGTGACGTCGATGTAATCCGTCACATGAAGATTGAAAATCCTCCAAGTCTGGCTCAAGAATTGATTTCCTTGCCATGGATGAGCAAGA
AGACGCTGAAGCGTAGCCTGGTGAAAGGCGAAATTTCGCAAATTTGTGTGATCGTCGATGAAGCTGCCGGCGATGCTATCAACACTGCGGAAGTGTTAGA
TGAAAGGACACGGAAGGAAAGGTTTGATGAGCAGTCGTGGGACGCTCTAAAGATAAACCCCGTGTATGGACTTGTCAAGGAATATGCTGACATATTTCCA
GACAAGGTGCCGGACGAATTGCCGTCGGACAGAGGTATTCGTCATGAGATTGATGTACTTCCTGGCACGAAGTACTGTATCACACGACAGTGGCCGTTGC
CAAGAGAACAAGTCATTGCGATCGACGAGTTCTTTGCGCAACGCGCGAAGGCTGGGCATGTGCGGGAGAGCAAGTCTCCGCATTGTAATCCCACTTTTTG
TGTGAAGAAGGCGACTGGCGGATGACGCATTGTTCACGCTTTCAACAAGCTGAACGACGCGACGATTCCAGCCCAAACTCCGGTTCCACGCAAGGATATG
ATCCTTGATGGAATGGTTGGCAGTACAGTCTTCAGTGCTATCGATCTGAAAGATGGATTCTATCAGATTCGTATGCGCGAAGATGATGTACCATTTACAG
CAGTAAGCACCCCTAGTGGTATGCTGTGGGAGTGGATGGTGATGCCACAAGGTCTGAAGAACGCACCAGCAACTTTCAACAGAATGGTCACGAATGTACT
TCGTCCATTAAGAGAGTTTGCACCGAGCT