Description :
From Genome Similarity Track
Location :
Scaffold_1886:2014- 5051
Transcript NameFunction/comments
Phyag_g11682hypothetical protein PHYSODRAFT_342106
Phyag_g11683hypothetical protein PHYSODRAFT_311662

Sequence
3037 bases(100 bases per row)
TTGGAGCCAATTAGTGGCACAGATGAAATACTGTAGATCAGCGATTGTTGCCGGCAATGGAAGCGCCGATAAGGCCTCGACGCGGGTCGGATCATGGCGG
ATGCCTGCACCCGAAATTAGCCGTCCACACCAGAGTACCTCAAGCTCGAATAGCGAGCATTTAGCCATGTTCAACTTCAAGTGTGCGCCGGCTACCAAGG
AGAAAAATTGGCGCAATGCCCCGACGAACTCGTCAACAGTTGCTGCGAACAaaatgacgtcgtcgacccACACCAGAGCCGAGTGGGGAATCATAGGTGA
CAGTACTCGTTGCATCGTCCCCTGGAAGTGGAGGGCTGAGTCTGTGGCACCTTGCGGGACACGCTTCGGCGTAAATACGCCATCTTCGGTGATGAATGAA
AATATCTCTCTGCTGTCTTCATGAAGGGGTAGTTGCCAAAATCCCTGGGTGAAGTCAAATGAACCAAAGACTTTCTTGCCATTGAAGGCATCTGTAGTGG
TAGCATTCGTGGGCATCGAGCCAGCGATTGGCACCGTCACGCGGTTGACCGGTCGGTAATCAATAGTCAGGCGGAACTGGTCGCGGGTTCCTGCCTTGCG
GACTGGAACAACAGCGCACGCCCATCTTGATGAGttgttcttctccacaaGGTCGTTGTCAACTAGCGATTTCACATATTCTCTGATGAACTGCGCTTGC
AGCGGCGCATATTTGCGCACCGGACTACGGTAAGGAGCAGCACCATTTTGAATGGTCACTCGGAGAGGTTCGACGCGTGCAGGCGGGTCACGACTGACAG
TCTCGCGCCAAATATCAGGGAACTGTGACAGCATATCACGAACTGTAGGCGCGTGCTCAGTAGGTAGCCCATTGGAAATCGCGCGATCAATGAGGTCATC
AAGACTAGCAATGGGGGCGGACTCCTCATGCTCATCCGGAAGCCCGTCACCAACAGGAAATTCGTCGGTGTCATCATCTAGGAGGGACGGTCTGGCGAGT
TCGGCAAGTTGACCCTCGACATCTATGCCTAGCTCCTTCAGAGCATCACggccaagcagaagctcgtCACCTTCCCCCATCAAAATCATACACGACACCG
ACCGCATTGCAACTGGNGCAATCTCCTGCCTGCATGCCACACGTCGCCCATCAGCCATTTCCACGTCGACGTTCGTACTTAGCGTGGCGGGGGCAAGTAA
AGGCTGGACTGCACGGAGAGAATCAACGATGCCTTGCGGGATAATGCTCCTATCAGCACCTGTGTCGGGGATGTACGGGACTTCGAGAAGCCCATTGATG
CGCACAGTTCCAGGAGGGGTGGCGTACCGTGCAGTTTTTGAACGGAGCGTGCCAGAGCGCTGTTCTTTAGCCTCCCGGTACTTCTGCCGAGCCTCAGCTT
GCTGTGCCTCCGTGGCAGTGGGGCAGTCCTTGAGCCAGTGTGGCCCCTtgcacaccaagcagccgTCCTTGGGCGGGGCGCGCGAAGGTTgcggagcagg
tgcagccGGCGCGGTCGAACTCGGTGTCGGAGATGCTCCTCTGTGGGGAGCTGGCTTGGGGGCTGCggtgcgctgctgcttccggtCCGTCTTCGGCGCC
TTTGCGTCAGTCTTGCCAGCGTAGTCTAGCGATATGCGATGGAATCGCTGCTGTATTTTTGCATGTTCTAATATCAGATCAAAGAGGGCAACATCATCAC
TTTTGCAGTCACGCCTCTCTAACTCGATAAGACGACTGATTTGCGCCTTGAGCACAGGAGGCTGCAAGTTTTCGACCAATAGGCGACAGCGAGCCTTCAT
TCTGCTCTTGTAGTCAGGATTCTCCTCGTTGTCAGCACCAATTAAACCTTGGAGACCATTGTCCTCCACAATCCTATTGAACTTCTCGTAGTAGCGAAAA
ATGCGCGCGTCACAGTCCTCAATTGATAAGTCCATCCTTAGGTTCGCACGGAACAAAGACGAGACATCTGGTACGAACTCATTTTTGAGCGTGTGGCATC
TCGACACTACAGCGCCCATGATGTCCGCGTCGGTGACAGATGCTACCGATTTCTTCAATACGTACTTAGCCAGGTTCTTGAGCGTCTGACGCCTCACCGA
ACCTTTTACGGTGGCTACAACATTTTGGTACGTCTCACCAGTCACGGTGCAGCGGTGGCGCATCTTTTCCTCGTAACGCTCCCACTCGCGATGCCACTCG
ATCAGGGCAGCATGCTCCCAGCTAGTCAGCTCTGGAGCCTTGATAACCTCAAAGATTGGTTGGGGGAGAGACATCTCCACATCTCCATCTGGGTCCACGG
TGTAGCGTGTTCCCgacatgttgaagttgcccgAACTTAACACTTCAACCGAACTTAACGCGCCCACCAAACTTTACCGCGAACTGATCCAAATCGCACT
TAGCCGAAGCGATTCGCACTTAATCGAAGTAGCCACGGTAGAAGTCCTCGGTCGCGGCGCGCACCAAAGAGACGAAGGTCCGGACTCTCGTAGTCCGGGA
TCAATAAACTCACGNCCAAAGGGTTGAAGTTCCACGACAGCGAGAGCTTGATCGCACAATCCGGCGACAGAGCCacggcaccgccaccgtGGCCCAAGTG
TCGTCGACGTTGGGTAGTCtgaccagcaacacgagtgAGATGGAGCAATTTTTCAGCAGCTGCTACGGGTACTCCATGTCGAAGGCAGCACTCAACATGG
TGACGCGTTCGCTGGCTGTCGGACTGAAAGGCAATAACATCGTGTTCGTCACGCTTAATCCAGGCTACGTCGACACGGACATGAACGACCACCAAGGCGT
TCTCAGACCCTCGGATGTGGCCAAATCTTTGGCTGACACCGTGGCCAACGTGGCCATGAAGGACACGGGCAAGTTCTACAACGCTGACAAGACAGTCGGC
GAGTTCGAGCTCCCATGGTAAGCGATTGGGCGAAATGCGAGGCAACTAAGTGCCTTGCTTCACTGTAGTTCCTAAGTGTAGGAATCGTGCTCGTTGCATT
GTTTGTAGCAGATGAACAAATGAACTTGGTTAGCAAC