Description :
From Genome Similarity Track
Location :
Scaffold_2068:2014- 4979
Transcript NameFunction/comments
Phypl_g14629reverse transcriptase

Sequence
2965 bases(100 bases per row)
CTGGTCGGAGTGACCAACTCACCCCGATCGTTCTGATCTCACTCCTCCTCGTGGGACTGCATCGCACCAAACCGATTCTGATTAGCGCGATCCCGCAGGA
ACTATGTAGGAGTGTCCCACAGTTGAGATCTGCTTTGTCAACCCAGCTGGGCTCTGCAAACCCCTTCCAGTGCACCAGGAACTCTCGGTAGGTCCTACCA
TATCGCGTCCTCCGATCCTTCCGCATATCGGTGATCCGTTCCACTTCGTACTCCTCTGCGTTCAGATCTGAGGCCCAACTGTCCTCTGGCAGTAGGATCT
CGTCAAAATCCAGCCGACCTTCCTCCGGTACAGCTAGCTCGACCTGCGGTCGATCTGGGAACTCCCGGACCGGCTTCAGTTTAGGGAAGAGTCGGTACTC
CGTCCCGGCGATCTCGAGTCGCATGGAATACTCATTGACCTTCTCTGCAACGCGGAAAGGCCAGTGCCACAGATGTGCCAGCTTACGCGCGTATCCCTCT
TTCACCCGATCCAAGTACAGCCAGACTTGTACTCCAGCCTCGATCCGATGTGGATCGACGTCATCAGTATGCAGACCGGCCTGATCTGCGAtcgccttgc
gcagcttATCGTTGACCTGCGCCCTCGCCTGAGTGTAATAGCGCTGGATCTGATATCTCCACCTCCTAGGGTCCCGATCTCGCGTCCGCGTACTACCCAG
CGGCACGGTCGCTTCCAGCGTCGATCTCGGATCCCATCCATGTACCAAATAGAAAGGCGAATCTCCGCGGATCCGATCCTGAGCCGTGTTGATAGCGAAC
GTCAATCTCTCGGCATACTCGTCCCAATCTCGCTGATCCAGATCCTGTACATACATTTTTAatgcgcgcgtcgtcgtctgcaccaTTCGCTCGGCCGTTC
CGTTCGCTTGTGGCCGATAAGTCATCGTCGCCCGATGTCGTTGACCGAGGATCTTATTAAAGGCACGGAAGAAGTCGGACATGAACCCTGGCTCCCGATC
GTGTCGGATCGCCTCGCTAGCTCCAAACCTCCGGAAGACGCATTCTTCGTAGGATTCGGCGATCGTCTGAGCCGTTCGGGACGCGCTCGCCTTTGCGATC
ACGTACCCGGTAAAGAGATCTACCCAGATCAACAACTCAGTGTTGCCCTTATATGACTTCGGGAGAGATGGTATGTGATCCATCGCAATGATCTGGAAAG
GATATGTCGCCTGGAGGTTCCCGGGTGATTCACCCCTGATCGTAGGTCGGCCCTTGTCCGTCTCGCAATCCACACACTCACCAACATATCTCTGCACACT
TCGAAACAGACCCTTCCAATGGAACTGTTCTCGGATCCGTTGATAAGTGCGGCCGATCCCTTGATGACCGCCTTCGATACTCGTGTGATAATGATGCAGG
ATATCTTGGTGGAGCGTCTCTGGAGCGACCAGCCTCATCAATCCGTCCCGATCGGCCTCCGATTTTCTGTTAGGAGGGCAGTAGAACAACAGATCGTGGT
CGTCCACTTCGTAATCTGTTGCCATTTTCCCGTGCGATCTAGCCTGATCTTGGGTGAGATCCGTCACATCACCAGCGAGATATTTCTTCATGCCTGAGAT
CCAACCTTCTTCGACCTCCGCCTGTTGGATCCGCTCGATCCGGAGGTCTCGGACCAACTCCTCGTTCAGAACAGGCGGGTCAGATCGGGGTCGAGCGGCT
GATCGGGTAGTCACTGGCGAGAATCGTACCACTGAATCCTCCGATCGGGTTACTGGGAGCTCGTCTAACCGATGTAGGGTGATCAGATCCTGATACTCTC
CCTCGcactccaccaccacgccttgctgtcgctggagggCTGCACCGGTTAGACTGTCCGCACTACCATTCCAATCCCGTTTGACATGCAATATCTCGTG
ATCGGGCCAGGAACGCAGTCGATCAAGGGCTTTCTGTCTCAACAGCGTCAAGCCAAGTGCCTTGCAATCGATCTCAACTCGGACTTGCCGGACTACTAGA
TTCGAGTCGCCACAGATTACCAGGCGTCCTTGGTCCATCCCATCCAGCAGGTCAAGGCATAGCAGGAGACCGTTGTACTCCGCTTCATTCACAGTTAGCC
CTTCAACATAACCCGACCGTGCCTTCAAGACAGTCCACTCGGGCAACTTCCACAAGGTCGCGCTGtaggcgccgccgccacgcttAACACGGGCAGATCC
ATCAAAGCTCACCACGAACAGCTCCTCGCCCGTCCCCACGGTCGGGATCGGTGCTCGGATCTTACGTCGTGACTCCTTTTTAAGTGCGATCGCAgtcagc
gcctcgtccactTTGGATCGGGGTGTGATACTCGCTGCGATCGCCCCTAGGATCTCGTCTTCTCCTTTCACGCACTTCACGATCTCGAGTGTCCAAGGTG
ATAGGAGAGCGGTCCACTGTCCAAGACTTCCCTGGAGCCCCGGCGATCTGAAAAGCCATGCCAACGTGGAATGCCTAGTCAAGATCCGAATCTGACGTCC
CACCAGCATGTTGTAGTTCAGATCCAAGATCCTCAAGAGGGCCAATacttccttctccaccacgttaTAATTCAACTCATTCGACTTGAGCGTTCTGCTT
GTGAACATGACGGGGTGGTAGATTTTTTCGTGATCTTGCACTAAAGCCGCCGAGATCGCCCACTCACGGGCATACACGATCACCACTGCCTGGCGATCGG
GGTCAAAGTGACGTAGGATCGGCGTCGTGGCTaccttcgccttcagcgtctcgaagGCCTGTTGCGCTCGAACCCATCTCTCATCCGCGGCCTTCGATCC
CGGTATTACGGGGTCCGATCCGGTCGTGTTAAGCATCCCGGGGTCGGGACTCGTGGGATCACGATCAGGCAACGATCGATCCAGCAACTGGCGGAGATCT
CGCCGCTTTCGCAGTTCAGCGAAGTTCACCTCACGTAACTCGTACAGGGCCGCGGCGTAGATCGC