Description :
From Genome Similarity Track
Location :
Scaffold_933:2014- 3034
Transcript NameFunction/comments
g16107.t1hypothetical protein

Sequence
1020 bases(100 bases per row)
CTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCCCTTTGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAATTCC
GCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGC
GTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTC
GACCTCGACAAGCCAACTGAGGAGAGGTTCGCCCTCTCTTCCAACGTAACTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGAC
ACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCTTTCACGATGAAACCCAGAGCAACACCGTGTGGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTA
CCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCCCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGT
ATTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGAACGGACTACA
AAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTCA
GTATACTTGTATCCACAAGTATACTTAAACCTAGATAAAGGAACCGAACGATAGCTTTGGTGCCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCT
CCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTA
CCAGTCATATGCCTTTTGCT