Description :
From Genome Similarity Track
Location :
Scaffold_46:201363- 209350
Sequence
7987 bases(100 bases per row)
AGTTTAACGATGATTCCAGGATGGTTAAATGTCATTTAGGCTCCAAGTTTATTAATGTTTCTTTATGAAATCTACTTAGGCAACTATAATTAACACCTCT
CGTGTTTTGTTGTCTTACCTCTCCATACAAAATTGTATCCTACACCCTTGTCGGCGACACGTCCACCCGTTATGTAGTACTGAATTTTGCTGTCTAAACA
ACTCTGGTTTACAGCAGTAACGTATGAGTTCTTTTTGTTCAGTCTAAAACTATCTACTTAGCCAACTATAATTAGCACCTCTCACGTTTTGTTGCTGTCT
TGCCGCTCCATTATAAATCGTATCCTACGCCCCTGTCGGCGACGCGTCCGTCAGCTAAGTAGTATCGGATTTTGCTGTCTAAACAACTCTTAGAAAACAA
TGATTTACAGCAGTAACACATTTGAGTTTAATCGAAGACTATCTATCACTATGGATCAAGTGACAACGCTTATTAGCAGCGTTGTTCTTACGGCCAGTTC
TTACGGCCAGTTCTTACGGCCAGCTTCTGTTGTACATGTACTACGATTTGGCAGCTCAGTCAGTTACCTCACCCTCCGATAATTTATATATATCAAAACA
GTTGTTGTTATTAAAGTCATTGTAACTTGCAGAAACCTTTATGATAGTGTATTACGTATATTAATAGTATAGCCTCAAAAGCACGCATTCCTACGTGTAC
GCTAAGCACCTTGCAGCATAGAAAGCGTCTTTAGGGCCTATTTCATTTGAGAAAAAGTAGCACTCAAATATTAAAAGCAGCATGCAATATTAAATAGTAA
ATATAATACTTCATGATACTAAAACGATACCACCTTCGGATAATGGATAGGCTTGTGCAAATCTCCATATGTGCTCTGTGAACCACATGAGTTTACTTAT
GTAAGCTACATAATTCAGTTTTAACCAATCGAAGCCGCCTTCGCTCCGCTCGGCAGCCAATGGGAAGACTCAAAAATCTGAGCGTTTCGTGTGACGGACG
GACGGACACCGTGCTTGCATTGATAGTTTAGGATATCCATTGGCATTGGTTCGTGTAACTTCTGTTAATGGCTTGGGATACCCTTTGGGGCGCTTGCCGT
CCTTCATGCAGGTGCATGAAGGGTTTGCAGGCCTACATGGACCATGGAGCATGCATGACATGACCGTTTCATACAGCTGATGATTTTTATCCTTATCTGG
GATCTCAGCGCATACCATCTTGTCTACGATATCGCGCGTTCGTCATTTGTCTTCATAAGCCAAAATAACTAATACGTGAGCGTGGGGGAGTCCTCGATTT
TGAAATTCGACAACGTAAATCCGCGCTTTCACTCTCCCCCAAATGCCTTGGTTAAATTGTCAGGCGTCGCTTGCAATTTCTGCTGCCACACGCTGGCCAC
GATGTCTGGTCCATCTTGAGCTGTCTGGACATCGGAAGGTATCGCTTTAAGAATCTCGTCCCACTTGGGGCTGCACGTTTCAGTCAGGAAGACGTCGGGC
CGTCCATATTCCCGAACAATTGCCACCGAATGTTGATACGACTTGTACATGGGCCGCGGACTTTCCAGGTGCTAGCCCGGTAGTAGGATACGCTTGCCAA
CCTGATTAAGAAAGTGGGTAGGTCGTCATCTGCTGCCTCCGTCCCGGTCCGGGTGCACCAATCTGTTCTAGGCCCTGTCATATTCCGACAGCAGCATTTC
TCCTTCCGCCAAAGCCAAAATATCTTCGTTGAGCAAGGCGTCTTGAACACCGCTCTATTGATCGGCGCGAAGTGTTTTCTGATTGTCGGCCTCCCAGCGA
AGCTGTTCTTGCTCGCATTTTGCACGCTGAGCTACACACCACTGTTAAAAAAGACGCCCGTCTTGGTGGGGAACAGACGGATCATCCACTTTCTGGTGAA
GCGGAATGCGACGTGTTCACAAAGCGATATCGCCTTCTTGTCTCGATACTCAGCACCATTTGCGAACTCGGCTGTGTAGGTCCAGCCCTCCTCTCCATAA
GGAAGGAAAAGCGGGTATTGGAGTGGATTGTAATCGGCGTGAGCCTCGTGTAAACGTAGCAGCCTATGATCGCGTATTAAGAGTCGTAGATCCAGATGCT
GAACTAGGTTGCCACCCTCAAGGAAAGTCGCAGCCACTTCAGACACAGTGGGGCGGTTATGCGTCCCCGGTCGCGATGTAGACGGAACACCACGTCTACT
GGACCCTTCGTGTTGTGTTGCTGCACTTCCTGCCCAAAGTGGAGGTACCGTTGCGCTAATGAGTTGTGCTCTGCCATCATTTTCTTGATGTCCAGTAGTG
CAACACGATCTAGATCCGCGAATATACCAAGACGCCGCTCCGCGCGGCGTTGCATGTCTGGATCTACAATGTAGCTGCGCAAACATGGGAGCTACCCCCG
CGCCTGTCCGATGGTCTGTGTGGGGGAGGAGAGACCCTATGTAGTGCTCCATAGCCCCTTGACTGCGATATGTGTACACGCCGTGTGTACCTGCAACGCT
CTCGTCTTGGCGTACGTTTTGAAACGATCATTTGAGCACGAAGGACCAATCGACGTAAACGAAAAGGCTGATTGTATGCACGGATTTGACGGCGATACTC
GGGGTCCCCGTACAGCTGGAGCAGCTGTGCTGGCGCGGGATGCAGTGGAGGCAGCTTTACCCTGCCTGCCAGGCAGCATGATATCGCAGACTCGCCAGGC
CACTTCCAAGCATTGTAAATAGGACAAACGGTTGTAGCCGGGAGCTTGTGCCGGCCGTATACCACGCCGTCACCCCTTATCACGGACACGTCGAAGTCTT
TGTGAGAAAAAGGAGCACGGCGATAACGGGCGCATTGAAGTCTAGTACGCACACGCTCGAACTCCTGTTGGCGTTCTTCTTCTGTCAACCTTGCTCTTCG
AATGGCTTGCCACTGTCGGTCTAGGTCACGTTCCGTTTCCCTTTGTTGCCCCGCCAGCTGCGCACGCCGAAAAGCGTGTTGTTCACGGTTTAGGTCGCGT
TCGTGTTGGCCTTGCGCTTGCGTCAGCCCTGCTCTGTGTATCGCCGATGTCTGTTCTGCTCGGGTCGCTTCTGAATCTCCTCTCCGCTAGCCCTTTGGAC
ATGCTTGCGCTCATCAGCTTTCGTCCTCGCACAGTCGCGCTGAGAAAGTGTCATCTTACTTCGTCACGCTGAGCTCGCTGTGCGTCGCGTGTTCATTCGC
AATCTGCCTGAGACAGTGTCCTATTAGCTCTTTTGTCGCGAGCTCGCGGCGCAGCCGAGATCGGGACATCGTCTCGATCCGCTGGTTCAGATACGACAGG
TACTGTAAATAAAGCCATATCTTCAGTTTCAGCTTGGTAAGCTGCCTCCATTTCGGCCGCAAACCGGCGCTGAAGTACCACAGGATCGGACGCTTCCGGC
TTTTTCCCTCGCTCTTCAATACGGCCAGCTTGATCTTCCGTAGCTTCCGTAACCGCCGTAGCTTCTTGGTGGACACTGCGGACTTGAAGCGCTTTGTTCA
AGTCACAGCGCTTCCTTCGGCGCTTGTTCATACGTTGCTTCCGTGCTTCCTTCTCCTGTCGCTTTGATCAGTTCATTCTCGCTCAGGGCCTCCTCAGGCT
CTTCCCGTGTCCTCTTCGGCTTTGTTCAAGCCATACGTCGGCGAACACGAAAGCGTGACGCGCTAAACAAAGTCTAAGTACACCGCACGTAGCAGTAGGT
TTTCAAAACGTAGGGTGTTGGACATCTGCTTACAACCCGGGATTGCTTGCTCCCATCAAGGTTATCTCCGATAACTTATCCCACAGTCACGGGCCGTAGG
GCTCGGAGCGGTTTTAGTTTGCAAAATTGTGCAGTCGAATATTCAGATTTGGTCCCCGGATAGTACTGAAGCTTGTGGTGCGATTCCTTTTCTTAAAAGG
CGGCCGTTAATTGCAAAGGCTGGTTATTGATAGGCTATTACAGCCCCCATCCTATCTGTCGGTCAAAATAGGCCAGTTACGGTACTTCTCCTGACCAGCT
GCACGCACGCAATGCGCGTGCCCATTAATAACCATTAGCGACCGGCTCAGCTGGTAAATGGATCAGCGGCCAAATGTGCTCTTGCGCAGAGTGGGCGGTG
GGATAAAGCCCCAAGAACCTGAGCATTCTGGAGCCAAACCCCCTTAGCACGGGCTACCTACTTGCAGGATAAATCCCGCAAGTTATAAGCTACTCCCTAA
GCAGCCCCAGGAACCTCGGACTATTTGTGAATGTGTGTCTTACTAGCTACTAACGCAAACTAACATGCATACACGCAGCGTACCTTGAGTAGCGTGGCGT
TCCGCGACTTCCATTTCGAAAATGGTGGCAAAATGAAATTTGAACGGTGCATTTAAGAAAGATGTGTAGACCACATACAGTGTGTACACCACATATTGCA
ATTTAATCGAATCCACGCCGCCTTCTCTACGCTCGGCAGCCAGTAGAACGCCCGCATTAGCGCTACATTAATTAGCCCTAGCCCTTTATGGATGGACGGA
CGGACAGACGCATACCACACTTCACTAGGGAGCTTTGATGCATGTACTAGCGCTCTGGGCGCCCGATCCGCGGACGTTAGGGCATGGTTTGTTGGTGTAG
TACAGACTGAACGCCTACGCTGCGCTGCAGCGGATTAAAGAACATTTCAAAATCAAAGCTAAACGTATTAAATGTATTACGTGCCCTACCAATTCCGCGC
TCCAAAGATCTCTCTGTACACAATATTGTTGGTGTGTAGGTTCCCGTTCTCATTGATGGTCTCTGGATCCACAGCAATCTTGATCGCCTTCCTTGAAGTC
ACTCCCGACATCGCCACACAAAGCTGCCCATGTGCGAAGACAGATGATTCCAAGTAGATACCCACGTGGTGCATCAATTAGCCTTGGACCTTGTTGGTAG
TCATGGCGAACGCTGGAGCCACCGGGAACTGCTTACGCTTGAGTTTGAACGGGAACTCCGTGTCATCGTCCTCACTATAAAAGACGATCCCAGGACTGAA
CACCATTTTACCCTTGAATGATCCGGACATAATGCTGGCCTCGATGCTTCTCTCGCGCAGTGACACAACTAGAAGTCGCGTTCCGTTGGAAAGCCCTGCG
TCGTTATTCAGGTTTATAAACATGATGATAGGTGCTCCAACCTTCAGAACAATCCTGTGCAGAGGAATATTGGAGAAGTAAAGGGTGTTTCGGCGTTCCT
GCTCAAACAAATTTGCGTCCGCGACCCCTTTGAGGCTGTCGACCAAGCTATACTCCTTCATTTCACTCGACAGCCGTTCCGCAACCATATCGTTGATACA
CCGAACACTAGCATTAGTCGGGGCTAGTTTGGCTCGCTCAACGAATAAAAAAGCGTGAAATGCTCAGTATCAGCCCGGGTACACCGCATCTATGAGTGCG
TTGACGTTGCGGACTTGTCAGTCTTCTTCAACTTCATCCAAGTCTTGCTCGTGCTCCTCATCCACCGGAGGGAGTAACCGGAAACTTGGGGGAGATTCCA
TATCCGCTTCTTCTTCACCAGAGGTAAGTTGCTGTACCCGTCGTTCTGGAATGATACACATGGTCGCGTGGAATGCATATGGCGTCACCATTAATCTCAT
GGCTGACCGGATAACGGCCTTCTCCGATTTGAAGTAAAAACCAGAGAGTTCTGCTAGCTTAGCTGCACTGGCCGCGCCTGGGGCGGTGCGGACACGCATG
TTCTCGGTCAGCCACACTTGACGCAAATGCTCCCATAGCGGCGAAGACTAAAGGCAAGATCGGCTCATCATCAGCGCTTCGTCCCAAATGACCCAACTCG
CGCTACAAATTCATTCGGCTTCTCGTTCTGCCAGGAAAGGCTGCACGTCGACGGCTCGGTAAGTTTGACGGGAGTCCGGGACGTCGAATGCGCAATATGA
CCGCCTGTTAACAGAGTGGCAGCAATTCCACTCGATGCAACCGCGATGGCAACCTTTCGTGGTATCCGAACGTGATCAAATATTTGCTCGGGTTTAAACG
ACTTTCCTGTTCCGCCCGGACAATTCAAAAAGAAAAGCTTCTTCCCTCCAACCGACGCCGTACCCTGGTAGCCCACTTGAGCAGAAACGTCGTCGTAATC
GGCTTTATAGCGTTTTGCCTTCGTGCGGTAGAAGTCTGCAAGAATCGATTGGCTTTAGACAAATGGAAAGCAGACGGCTTCGAATTGACCCCACACGCAA
TGAACCTAATGACGCAAGAACAACGCGGCGTCGGCAATGCCTGCGGGCGTATCCATCTTCCTCGTCTTCGATGCTATTGATGCGTCGGGAAAGGTTGGCA
ACGTCAAGTTGTACGAAGTCAACATGTCTTCTGGTCAGTGATCGCGATGTGTGGCTTGTGAGCAGCTCCGGATCCTGTGCCGCCATATTAAAGCTGTAAT
ATACCGACTTGCATCCGATAACAAAGGGATGCAATTGCTGTATAGACCTCTGCAATACTTTCATGGTGCATATTCGATAGACGTGCTCCACGCTGCGATG
TCAACTGTTTCGATACACATTCCGACCGACGCTTCTGCTGATACGTGCGAGACGATAAGGCCCCCGCCTCACTATCGACAAGCTGGAACCTCAATGAAGG
GAAATCCCAAAAGGACGATCACGCTTGGGGCTCAAAGCGAACGCGTAACAAAGGTAAATGCAGGGTCAACAGCGCAATCCGACCTTGACAACAACGCTGA
GGGAGCCTCAGAGCACGCTGATGCTGTAGAAGCAGAAGTCGGAGATGGAGATGAGGGCTCTGACATTGCAGCCTTCTTTGATACACAACTAAGTGCAACA
ACAGTGAAAGGGCGACGGCAATATCGCTGCGGCCAATGCAGCGATACCAACCACAACACAAAACATACACAACCGTAAACCAGGAACGTGAAGAAGCAGG
AATCCCAATCGTACCCGGAAAATATCTTGTTGGGGATTGCCCCTTTTCCATCTGCGGAATTCTGAGTGGATATGAAAAAGTAGTTGATAGTTAGAATTCC
TCAGATTCATTTTAATAAATTACAATTTTAATAATTTACAATAATTTAATGCAAGGACAACCATTGTGTTGGGTGGAGGGGGCTGTCAATAAGTTTTTCC
AGCTTTCTCGTTCACTTTTTAACAGAAGCTGCCAAAACATAGGATGTACATCTTCGATAATCCTAAGGAACGTATAACAAGACGGAGTACTGTGAGGGGC
TGGCAACCAGTGTAAATAATATCAGAAAATACCTTAAGTTGCTGTGCTGTCGTCGATGCGAGCTCAATACAATCAACATATATTTTGAAAGACAGGCATT
AAAATAAACTTCATTCAGATTGCTTCGTGTTTACTTACGCGTGTAGTAAATGGCCCGATCATCATCTCCAATAGCCGGCCACTCAGCGCACATTTCTAGG
TTTGAACAGCACTGCGCTTTGTTATCACACTCCGCGCGCTGCAACTCCCTCGGTGGTAGGGTTTAGGTGACGCAGGGCGCGTCACTGGACTGCTCTCTAA
GCGTAGATCACTTCTTAGCGTAGGTGCCATTAGAATATACTTACACTTAAGTTGAAAAGCAATCAAAAGAGGTACGTAAACACAGTGAGTGCCGGGAAAA
AGGCCACGACAGGGCTGCAGTACTGGTGTGGGCTTGCTCTTCTCTCTGGGGTTCGCTGAGCCGCAAATTGAGTTGTGAGAGAGAGAGAGTAAGCCTCACG
CAACCCAGTACGCCTCTCCGCAAGTTCTATTTGATACATAAACTAATGTAAACCATACTTTACCGACGTCAGTGTCGTCGTGAGCAGCACGGCGGCACGG
TCGCTCTTGTCCATCGATCATAGTAAACTTGGTATAACCGCACACATCCGCACGTGGCACGTCGGTAAGTGCGCAGCCGCAGGCTGCAGCAACAGGCGTA
GGATAGGATGCAGGATCGGCTGTCAGTGTCAATGCCAGGCACTGACAGTCCACTTGTACTGCTGGTGCTGGCCTCTTCACACAGGGG