Description :
From Genome Similarity Track
Location :
Scaffold_13:201357- 203023
Transcript NameFunction/comments
g18345.t1hypothetical protein

Sequence
1666 bases(100 bases per row)
GCGTCGGAGCTGCCGTTCCCGCTGTACTCGGGCTTCTTCCCGCAGATGGTGCTGACCGTGGAGGAGCTCATGCACTACCGGCGCTTCGGCAAGGAGCGCG
TGGCGCAGCTCGTGCGCATCATGGAGGACGCCGACTGCGTCTACCGCTGGACGGACGTCAAGGCGCGCAACGGTCGAGCCGTGCAAAAGGCGCAATTCCT
GGACATCCAGCCAGCCTCCAAGCAGCCGGCCACACAACAGCCGTCCACGCTCTTCAAGTGCAGCGTCCACATTGTGGACGTGCAGCCAGAGGAAATTCTG
CAGGCCGTGGCCAAGGTCAAGACCCGCGACGCCAGACGTGCAATGAGCTACTTGCACGCCGACGAGTTCGTGGACACGCAGACGCTGCTGACGTTCCCCA
CGGCAGCGGAGCACAAGACGCCCAGCTATTCGTACCGAGCCATCAAGTGGGCGCTGCTCAAGGCGCGACGTCGAGAAGGCCAGAAGAGCCTCGACTTCTG
CTACTTGGAGTACGCCGGCAAGAGGAAGCCACACGCGGCGGCGAGCAGCGTCGTGGGCTTCTGTGTACAGGAGTCTATTGCCAGGGACCGAGAGGTGCCG
ACGCTCGAGAGGTACGACATTCTGCGCGGACAGTTTGTGCGCACGGGCATCCTCGTGACCAAGACGCACCAGTCCAACATTCTAAAGATCACGGCAGTGG
CACAGGTGGACGGAGCCTTGGTGCCGGCTGCAGTGAGGCTGACGATGGAGGAGATCATGCTGGACTTTGTGGCGTCCGTGCACCGTGTCAAGGGGCTGCT
GGAGCGCCAGCGGATGGGCAGGTTGCAGTATCTGGACGAGTGGGACTGGGTGTCCACGAAGGAGCGCAAGGCGTGTGCAGTTTGTCTGCGGGGCTTCTAC
TTCCATCGGAAGCACCACTGTGCCACGTGTGGAGAGGTGGTCTGCTCGAATTGCGCCCCACTGCGCGAGCTGGACGAGCCGCTAGATGAACACACGCACA
GTATGCGCGTGTGCTCAGTGTGTATGGCACAAGCGGGCAGTCAACGCCAGAGCAGTTTCAGGTCGGGGGAGACTGAGAGCGAGGACGGAATGCTCGAGAC
GACGACCACGACGACGAACGTTGGCACAGAGACCTACGTCAGTGGGCTGCGGTATCCCAAGCACCGCGGACTGCGGAGAGGAGGCATAGAAGAATCCTTC
AAAGGGTCGTCATCGCAGGCGACCCCCGCGCGCTCACCGCTCCCACCGTTCCGGCAACAGCATCGCCCCCTGTCCAGTCGGAATAGTGCTCAAAGCAACG
AATTGGATTATGGTGGCTATGGTAGCGACCACCACCCGCGAGCAGCGTCCGAGTCGGCGAGGCACGAGCGACGCTCAAGCGTATTGCGCCATTCAGAGCT
GTCGGCAACCTCCGTGTCTTCCCAATCAAAAAAAGAGGCTCTAGATAAGCTCGTTGAACACGTTCGGCAAATTCGCGACACGCTCAACATGGCTATTTCG
GAAGCTGAGGAGGAGGAAGAACGCCACAGCATGCTGCTTGAGAGCGGCCACGGAGACCCGGACGCTGGAGCAGAGCGATACGATGAGATTTATGACCGTA
TCATGAGTATCCGTGAGACGCTGGACGTGTCCAGTTCCGACTTTGACGCGGTTCTCGAATCTATTG