Description :
From Genome Similarity Track
Location :
scaffold_7:201351- 203589
Sequence
2238 bases(100 bases per row)
GCGATCAAGTGAAGCAGGACAAACAGCGAAATCAGAAGCAGTAACGACGTTTCCGACGTTCGCAATAAGTGCGAAAAAACGGTTCTAAACGAAGTTGTTT
TCTCCTTTGTGCAAGATGTCCGGCAGCGACGATCCTGACCATTCCATCACAGCAATGCTCGAGTCGTGATAGACGTTTGTCCGGGTCAATATTGAACACT
TTGTCGTGCGTTTGCTAAAGAACTTAGAAGCGCAAAGATCCTGAATCGAATCGTTCTAGCGCTCTCGCGAGCATATTCGTAGCTGCAAATCACGTCAGGA
ACATCATGCTTAAGAGACTCTCGAGGTTTTCAGTGTCAGATTCAATTGGATAGATAAACTGCTGTACTCTATGAAAGCGTTGACGGCTCAAGTCTCTTCC
CCTGGTCGATCCTCGTGAGTAAGTACTAACTGGGCGATCCAACAACGCTTTTCCCCAGGATGAATCAGAAGGGATGGGGCTGATTGCAAAAACGATCTGT
GGATTTGAAAGTGGAAAAGCGCTCATCGTGCTTAGGTGAAGTTTTTTATGCGGAACTATGAGACCGGTGAAATAGCCTCGAAGATCAAATGAAGAAGCAT
ATGCCGAAGATTGATTTGCTCTTTGATAGTCTAGTCCATCATCCGAAAAATTGACTCTTGGTTTGTCCAGAGAATTAAGAAGGTTCATGCAAGACTTGAG
TGAACTCAGCAGCTCGTGATGCGTAACCCTCAAAAATTCACTGAGTCAAACTTAACTCTGTGACGCCAATTAGGTTCGACTGTGGAGACCTTTCCAGCTT
ATGACCTGACACTCTAGAATGGAATAATGGCTAATGTATCGTGTAAGTGATCTGTGGAGATATGCGTAGATTTGTTCAACGCAAACTTTGCGCGTTGGAG
AAACTCATTCCACTCTTCGAAAGACATCGCGTGGCATTGCAACACGTCTTCCAGGACGCGATTCACTCGTTTCCATCTGACTGCCTGTTCTGAGCGTGCT
ACTGCTGACGTGAATGGGCTCGTATCCAAATTATCACGCAGAGCACGCCAAAGAAACTTTGGACGTGAACAAAGGGACACAACTTCCAAAGGTAGACTAT
ATAGGCGGAGCTTTACGTCTAAAAAGATGTCCCAGTCATTTTTGTTGAGATCTTGTACGAGACCACACCAACTTGATAAATAGGTCCACAAACATTAGAT
TTTCACTCGTGCAATGTTTGTCAGTTGAGGGTTCAGATACTAAATCCGACACTTGTAACAGTCGAGTGACGCGCTTGTCTTGATACCAATCATTTGGACT
CGGCTTGCTTGATGTCGAACTTTTCTTGCATCGCACGTTTGATGAATGCGTCGAATGTCGTAAGGTACTTTCAGAGTAATTAATTCTGGATCGGCCCAGC
CTCAAACTCGCCATGAATCTTACAGTTTGCGTTATAACTTCAATCGACCTGTCAACGATGCTCGATCTCAAGCAGCGTCGCACAGTGCGAAGAAGTGTGG
ATTGTTATGACCTGAACATAGCTTCAAAAACTTGTCACGGGCAATAACCTCACTTTGTGATGGCTCAAGCGCCCACAATAGCTCGATCTTAACGCCTTTA
AAGCTAGGAATGCTGTCAAGATCGCTTAACGCCTACCATAAACCCAGTCCTTTGGACGACCTGCAAGATTAGATATTGCGAACAACACATGCTGTCGAAG
TTGTTTTGCAGTGACTGCCGCATCCAACCCGACAAACCGTCATGAATGAGGCTAAATCTCTCCAACACGATACAAAGACACATTCAGCTTCCGAGGCATC
GCTCTGTCAGAAGAGACAGGCATTGCAATCTGCTTCCGAGATTTCATTATCTTAAGATGAATTTATCTGACGAGCTGCGTTCTTCTGACTATTCAAGGAA
AGCAACTGCAGTATGCTGACCGCAGCAGCTTCTTCAGTGACTCCTCGTAtctattcaaaattgattaCTCATCTGAAGACAGTTTAGGAAACATCTCATA
TGTTAGCATCTCGGTTTGCGGTACTGATTAACCGAGTAGTACTCCAACTCTCTCTTTGTCACTCGAATAAAGATAAGTGTATGACTTGGACAGAAACGTG
CGACGTGCTTAATAATCTCATCGTCGAACCGGGAGTGAGTGTCGCTGGAAATACCGCTCGAAATGCTGCCAGGTGCAAGAGGGCGCTGCTCTCAACTGTC
CCTGATACACTCCTCAtaagcttgtgcgacgaggaagc