Description :
From Genome Similarity Track
Location :
Scaffold_83:20135- 21750
Sequence
1615 bases(100 bases per row)
CCTTGTTGACACCCTCCACATGCAGTTGCTCCACCCGACTTGAGAGGGACTCTCACATCCTTGATCATGTTGGTAGTGATCATCTTGCGAAGTACGTCGA
CTGGAGCGTGACCCATTTGCGCATGTAGGTCAGCACAACTGTTTCCACTTGTTGCCACATTTGCTGATCGCTGAGCCGTACGAATCCAGTAAAGACCATC
CACGAGATCCGCTGTCGCCACCACTTGCTGCGAGTTCTTGCGAGTCACATACATCTTGGACCCGTCGACCACCACTTGGAACTTGCCATGCTTGTTGATC
TGTGGCACCGGAAGCAGGTTCTTGCTCATACTTGGAACATATAACGCGTTCTTGATCTCGATCTCGCTCTCTTCACCGTTGGGCAGAACCACCTTTTCAA
TGATGGTTCCCACACCCTTGATGGCCACCTTGTTGCCATCAGCCACCAATAGTTCGCCATCATTGCGCTCTGCCAAACTTGCAAACTTGGTCTTGTCGTG
GCAAATGTGGTGCGTTGCACCACTGTCGACGGCCCACATTCCAGACACGTCCTTGCTCGTCGAAACTCCACATTCGAACGAAACTGCAAACGCCACTCGA
TTGTAGCCATTGCTTCATCATAATGTCCCCACTGGACGTTATTAGCCCCGCGTCCACGGGCATTGCCGCCGCGTCGGGCTCCTCGACCTTCGTTCTTCTG
CTTGGTCCAGCAACGATCCACCGTGTGCCCCACCTTGCCACAATACGTGCATTGGTAGAGCTCACGCTCGGTGCTGAACGCCTTGCTTGCATCTTCAGCC
TTCACCGTAGTCGCTGTTGTCGTCCCCTTCTCTCCTTGACGCTTGGCGTGCTCATTCGTCAGCACCCTCACCACGTCCTGGGTACGAAGCTCAGCACTGC
TCATTTCCATGTTGAGTACCACATTTTCGTAGCTCTTTGGGAGACTAAGCAGCAAACAGATTGCAACGTCTTCGTCCTCCATCTTCGCACCGATGCCGCT
AAGCTTGGCGGCGATGTTGAGGACCTCATTGCAGTGATGCCTGACGTTCGCGCCTTCAGCCATCTTTGTGCTGAAAAGCTGTCGCTTGAGGTAGATGCGT
CCTGCCTTCTGCGACCCACCGTAGAGCGTCTTCAGGCGTGACCACGCGACCCACGCTTCCTCGCAGTTGTCAAGCACATGGTGATAATCCGCACCCATGT
GTAGCAACATCATACCAAACGCGATGTTGCTCGCCTTGACGTACTCATCGGACGCTCGCGGGTCGGTGAAGGTCGGAGTCGTTTCACGGTTCACGACATA
CCAGACGGACTTCGTCAGAAACACGCCGCGCATGTACCGACTCCAAGTCGCATAGTTGTCCCCATCGAACTTATCGATGGAGACGTTGGAGGATGCGTTG
GTGGTAGACGACATGGCGCTTGGGCTCATAACCTGTTGTAATTATAAGGGCGAAGCGAAGCGAAGGGAGCGGAGAGACCGAAAGGGGAGACGAAGAGACC
GGAGAGAGCAGAGCGGAAGACACTTGCTCACAAGTTGGAAGATTCGAAAGTGATTTATTATCGGGGCTTGGAAACCACTTACTACATGATTTATATGTGG
TGTACATATAGATCA