Description :
From Genome Similarity Track
Location :
Scaffold_1:201332- 205338
Transcript NameFunction/comments
Physo_477150multicopper oxidase, putative
Physo_472670SUMO-activating enzyme (SAE), putative
Physo_472674expressed unknown protein

Sequence
4006 bases(100 bases per row)
GGCTGCCTTGCTCGCGCTCCACCTCGGCTCCAGCGCCGCCGACCTCGTCACCTACGACTGGCGGGTCACGAACCTCAACGTCGAGTACGACGGCGTCTTC
ATCCACTCGCTCGGAATCAATGACAAGCCTGCGGACCAGGCCGTCATCGACGTGGAGCTTGGCCAAGACGTCGAGGTGCGCGTCACCAATGAGCTCGACG
AGCCCACGTGCCTCCACTGGCACGGCCTCAAGCAGCTCGGCACCCAAGAAATGGACGGCACGTCGGAAATCACGCAGTGCCACATCAGTCCCAACAGCAC
TGCGGTCTACCGCTTCACGCCCGATAAGGCCGGCACGTTCTGGTGGCACAGCCATCACATGGCCCAGTACGCGTACGGTCTGCGCGGGCCGCTGGTTGTT
CACGCCCCTGCGAATGAACGACAGGACTGGGAAAAGGACATCGATGGGGAGTTCGTGATCCATATGGCGGATCTCTACCACCGCCCGCCGCAGCCTACGC
GCATGTGGGACAACATCCTGATCAACAACCGTGGCCGCTACAACTGCATCGCCGCCGCGCACCACAACTTCACCGGGTGCACCGAGGAGCAGACCCTGTC
CAAGTTCAACTTCGTGCCTGGCAACAAGTACCTGCTGCGTCTCATCAACATGGCCGCGCTGTCCCCGATCGTCTTCAGCATCGACGACCACGAGTTCCAG
GTCGTCGCCGCCGACGGTGACCACCTCCAGCCCTCGAAGTTCATCAACTCGGTCACTCTCAACGCCGGCCAGCGCTACGACATCGTGGTGCAGGCCAAGG
CCGCGGCCGGCCAGAACCAGAAGACGGCCTTCTGGATGCGCGCGAACGGCCTCCACGGCCTTCCCTGGACGCGCGGAACGGCTGCGATCGCTGGCGAGGG
CTACACGTACGAAGGTCTGGCCATCATCTCGTACGGATCGGAGAGCGAGGCCGAGCCGACGACCACCAAGCAGGCCAACCTGACGACTGTGAACGAGTTC
GACTTCATGCCTCTCGTGCCTATCGCGCTGCCGGAGACCGCCTCGGACCGCGCCGTGTTCGAGTTCAAGATGCAGGACGGCAAGGGCCACTTCGCCATCG
ACGGCGGTGAGTACCACCACTTCATGTACCCGGAGGAGCCGCCGCTCTTCTCGATCGCCGCCGGCATGAAGACGGAGCAGCTGCCGGTGGAGGCCAACGC
GCGCAAGATCGAGTTCGGCAAGCACATCGAGGTCGTGCTCGTGAACGTCAAGGACGAGCAGCACCCGTTCCACATGCACACGCACTCGCCGTGGGTCGTG
GGCAGCGGCGTGGCGTCCATCGACCAGATCCGCAAGAACCAGCTGCCGGCCCCGCTCAAGCTGCTGAACCCCATGACGCGCGACGTGTACACGGTGCCGC
CCTGCACGTCCGACGGCAACGGCGGCTGCCTGGACGCCGGCTACCTCGTGCTGCGCTTCAACGCTGACAACCCGGGCGTGTGGATCTTCCACTGCCACAT
CGACTGGCACCTCGAGGCCGGCCTCTCCATGATCCTCGTGGAGGGCGAGGAGGAGCTGCAGACGAAGGGCGTCAGCGCCTTCTCCAACACGATCCTCAGC
GTCTGCGGCGCCAACAGCAAGTTCCACCCGGGCAACAACGGCACCTCCATTGCCGTCAACTAGACTTACTTAGACAACGTTAGCTTCAACTTGCACAACC
AATACTATTGGTCTAATAGACGCCCAATGACCAGTCAAATCACGCTACATTTTCAACCAATCACATGATTTAATATAATGAATTACTTAAGTATGAATTG
CGCACGGATCATCGAGGTCATGGCGGAGGAGCAGCAGGCGACGACGTTCAGCGCGGCGGAGGCGGCCGTGTACGACCGGCAGATGCGTCTGTGGGGCGTC
GAGGCGCAGAAGCGGCTGCAGAGCTCGCGCGTGCTGGTAAGCGGGCTCAGCGCGCTGGGCTCGGAGCTCGTGAAGAACCTTGTGCTGGCCGGCATGGGCG
TCACGCTGCACGACACGCAGCGCGCGACGTCGGCGGCGGCCGCCTCCCAGTTCTTCCTCTCGGAGGCGGACGTGGGCTCCAACGTGCGTGCCAAAAGACC
CCTCTCACTCTTAATTCTTGCTTCAATTGACCCAAATCTGACGCTACGACGCTTTGACTGCAGCGCGCCGAGGCCTGCCTGCCGCGCGTGCAGGAGCTCA
ACCCGCTGGTGCAAGTCTCGAGCGAGACCAAGCCGCTGGCCGAGTTACCGGATGAGTTCTTCACGCAGTTCACGGTCGTGTGCCTCGTGGGCGCCGACCT
CAAGACGGAGCTGCGCGTGGACGCACTGTGCCGCGCCGCAGGCACGGCCTTCTTCGCCGCGCGCAGCTTCGGTTTTGACGGGATCGTGTTCGCTGACCTG
GGCGCGCACACGTTTCGCCGTAGCGCCGTGGGGGCCGACGCGACGCCCAGCGAGCCCGTGATCGTCCATTTCCCGACGCTAGAGCAGGCCCAGAAGGTGC
AGTGGAGCTCGCTGCAGAGCGCCCGCAAGCGCGCGCCGCAGCTGCCCCAAGTCTTCGTCAAGAACCAACGTGAGTGTTGCATGAAAAGTGGAGTGAGTTA
TAGTAGTTGGTGCTGAATGTGTCTGATGACTACTGTGTGCAGTGCTGCAGGGGTACAAGAGCCAGAAGGGCGTGATCACGAACAACCACGAGGTGGACTT
TATCCAGTACGCGAGGGAGCAGTTCGCGGCCAATGGACTGAGCGAAGACTATCTGACCCCCAACGAGCTGCAGTACGTTGGGAATGCCCTACGTTTATTT
CCGATGGGCTCGTGAACTGATAGCAATGGCTGTGTCTGTTTGCAGGGCGTTGGTGCGCGTTGCGGACGCAGATCTTGTGCCGGTCTGCGCTATCGTCGCC
GGAATCCTGGGCCAGGAGGTCATCAAGGCTATCTCGCAGAAGGACGAGCCCATCTGCAACTACTTTTGCTTCGACGGCGTCACGGGTACGGTGCGCCGTA
TTGGTTAGAGGCACTAACTTGGTGAACAATATAGCAGCTCCGGAGCCAAAGCGCTCAAAGGAAAATGCAAGTATTTGGTGAGTTTGAAGTTGTATTCATG
GTGGTCATATATTCGGATTTGGATCCACGGCACTGAGCGATTCCTGGGGGTGGCAGACTTAACTGGACGCGTCAGTATCATTTGTACGTGTGCATACAAC
ATCGCGTTCTTGTGGGCTACATGAATGTAAAAAACATAAAATTCTATTGTAGTGGGCACTGCTGAAGACTTGTTCCACCTGAACACAAAAGTCTATATCC
TACGCCGGGGTATCAAGCTTCGACGTCCATCTTGTTGTTGCCGCCCGCCCTCTTGGCCGAGGCGGCGTTGGTCTTGTTCAGCAGCTCCTGGTTCGCCTGC
ACCACCGTGTTCTGCAGGTGGGCCTGGATGGCCGCGAACGGGTCGCTCTTGAAGCTCGAGTGGGTCTGCACGGCCTTGAGCTGGCCCAGCTCACGCACCG
CCAGCTTCTGGCGCTGGCGGCCGCTCAGGGCCTTCTTCTTGGTCTGGGCCTTGTTCTTCGTCTTCTTCTTCTGGTCGTCGTCCTCCTGGAACAGCGAGCT
CTGCAGCTCCTCCAGGTCGGCGAACACGCCGCTCTCGCTCTTCTTGGCCTGCGTCTGCTGCTCCTGGGCCACCTTGGCCACCATGCCCATCTTGCGCATG
AAGGCGGCGCGGCGCTTCAGGCGCTTGCGCTGGCCGCGGCTCAAGCTCTGCCCGTCGCCGGCCACGTCCGCGTCGTCATCGTTCTCTTCGTTGTCGTCGT
TGGCGTTGGCGTCGTCTTCAGGCTCCGCGCCGAAGGTGGCGGCCACGGCGGCGGCGCTGAGAGAGTCCGCGGGCGCCTGCGGCTGCTGCTTCTGCTGGCT
CGAGGAGGCCTTGGAGCGCGCCGCCACGCCGTGTGCACGCGCCTTCTTCCGGTGCTGACGAGCCATGGTTCGAGTGGAGGTGTGGAGGGGATGGAGAGAG
CGACTC